Treponema pallidum p15-17-47 fusion protein and recombination expression method thereof
A fusion protein and protein technology, applied in the field of immunoassay medical diagnosis, can solve the problems that TP cannot be cultured in vitro and the research of antigen is difficult
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 Syphilis Nihcols strain p15, p17 and p47 gene cloning
[0031] 1) Genomic DNA extraction: The Nihcols strain of syphilis was provided by the Guangdong Provincial Skin and Venereal Disease Prevention and Control Center, and the genomic DNA of Treponema pallidum was carried out according to the instructions of the Bacterial Genomic DNA Extraction Kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.
[0032] 2) Primer design: Download the whole genome sequence of Treponema pallidum subsp.pallidum str. Nichols (Accession No.U73117.1) from Genbank, and select the gene sequences encoding 15KD, 17KD and 47KD proteins by Blast. Use Oligo6 software to design PCR amplification primers from both ends of the three gene sequences, and the primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. The primer sequences are as follows:
[0033] Amplify p15 primer: upstream primer 1 is 5′-ATGGTGAAAAGAGGTGGCGCG-3′
[0034] Downstream primer 2 is 5...
Embodiment 2p15
[0049] Effective epitope analysis of three protein fragments of embodiment 2p15, p17 and p47
[0050] According to the whole genome sequence information of Treponema pallidum subsp.pallidum str.Nichols (Accession No.U73117.1) in Genbank, the amino acid sequences corresponding to the three protein fragments of p15, p17 and p47 were found. Amino acid sequences were used to predict the effective epitopes of the three protein fragments through the online epitope prediction server http: / / www.cbs.dtu.dk / services / BepiPred / . According to the prediction, select the 23-116 amino acids of the p15 fragment, corresponding to a DNA sequence of 67-348 bp; select the 30-145 amino acids of the p17 fragment, corresponding to a DNA sequence of 88-435 bp; select the 23-416 amino acids of the p47 fragment, corresponding The DNA sequence is 67-1248bp.
Embodiment 3
[0051] Example 3 Construction of recombinant plasmid pPIC9K-p15-17-47
[0052] 1) Design of primers for PCR amplification of effective epitopes: design primers based on the effective epitopes determined in Example 2. Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. The primer sequences are as follows:
[0053] Amplify effective epitope p15 primers:
[0054] Upstream primer 7 is
[0055] 5′-TAAGAAT GCGGCCGC ATTCTATCCCGAATGG-3′
[0056] (The underline is the EcoR I restriction site)
[0057] Downstream primer 8 is
[0058] 5′- GGCGGCGGTGGCAGCGGCGGCGGTGGCAGC AGAAACAGTTGCACCGG-3′
[0059] (The underline is the positive chain of the flexible peptide sequence)
[0060] Amplify effective epitope p17 primers:
[0061] Upstream primer 9 is
[0062] 5′- GCTGCCACCGCCGCCGCTGCCACCGCCGCC CCGCACGCCGGGAAG-3′
[0063] (The underline is the negative chain of the flexible peptide sequence)
[0064] Downstream primer 10 is
[0065] 5′- GGCGGCGGTGGCAGCGGCGGC...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com