Kit for isothermal DNA amplification starting from an RNA template

A kit and template technology, applied in the field of synthetic deoxyribonucleic acid

Active Publication Date: 2015-04-29
GLOBAL LIFE SCI SOLUTIONS OPERATIONS UK LTD
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently available RNA amplification techniques suffer from high background noise, which may be due to non-specific amplification reactions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for isothermal DNA amplification starting from an RNA template
  • Kit for isothermal DNA amplification starting from an RNA template
  • Kit for isothermal DNA amplification starting from an RNA template

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0110] Example 1 Amplification of DNA starting from RNA template, irrespective of denaturing conditions.

[0111] First Choice™ Human Spleen Total RNA was obtained from Life Technologies™. Oligos were obtained from Integrated DNA Technologies, Inc. cDNA:RNA heteroduplexes were prepared from total spleen RNA using Oligo SEQ ID NO: 1 with SuperScript® II (SS II) reverse transcriptase and accompanying buffer purchased from Life Technologies® and prepared according to the manufacturer's instructions .

[0112] Table 1: Oligonucleotide sequences used in Example 1.

[0113] SEQ. ID No. oligonucleotide sequence 1 5'-d[CCAGCCTGGGCATCCTTGAI*T]-3' 2 5'-d[TTCAGCTCTCGGAACATCTCI*A]-3' 3 5'-d[TCACGCCCACGGATCTGAAI*G]-3' 4 5'-d[CATCCAGTGGTTTCTTCTTTI*G]-3' 5 5'-d[GAGAGGAGCTGGTGTTGTTI*G]-3' 6 5'-d[TGCTCGCTTAGTGCTCCCTI*G]-3' 7 5'-d[TTGTGCCTGTCCTGGGAGAI*A]-3' 8 5'-d[GACGGAACAGCTTTGAGGTI*C]-3' 9 5'-d[CACACTGGAAGACTCCAGTI*G]-3' ...

Embodiment 2

[0125] Example 2 Reverse transcription using different reverse transcriptases

[0126] Isothermal amplification reactions were prepared and analyzed as in Example 1, wherein denaturation of the starting RNA template was performed at 95°C. For this example, increasing amounts of Moloney murine leukemia virus (MMLV; Life Technologies) reverse transcriptase (RTase), which contains both reverse transcriptase and RNase H activity, or SS II RTase (reduced RNase H activity ) was added to the amplification reaction. Reactions contained 12.5, 25, 50 or 100 units of MMLV or SS II as indicated. Amplification reactions containing either RTase synthesized fragments of the expected size, indicating successful amplification of the target mRNA in a single combined reaction of RNA reverse transcription followed by amplification, as Figure 5 shown.

Embodiment 3

[0127] Example 3 Isothermal amplification of RNA in a single reaction mixture without denaturation

[0128] Isothermal amplification reactions were prepared and analyzed as in Example 1, but without any denaturation of the starting RNA template prior to amplification. 200 ng of total RNA (from spleen or kidney) was amplified alone with or without 30 min RNase A pretreatment (to eliminate RNA, as a negative control). The oligo mixture was the same as previously used in Example 1, which had amplified the correct product size starting from the cDNA:RNA template. RNase A was not inactivated prior to amplification. 50 units of SS II were included in all reactions.

[0129] Table 3 is used for the oligonucleotide sequence of embodiment 3

[0130]

[0131] Table 3 contains oligomers of SEQ ID No 13 - 24, wherein "I" represents inosine and "*" represents the phosphorothioate bond in the oligomer sequence. Human genomic DNA was amplified under the same conditions using differe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method of amplifying RNA template is provided. The method comprises reverse-transcribing a ribonucleic acid (RNA) template to form a cDNA using a first reaction mixture comprising RNA template, at least one primer capable of hybridizing to the RNA template, a reverse transcriptase and deoxynucleoside triphosphates (dNTPs); and amplifying the cDNA to form an amplified product using a second reaction mixture comprising at least one strand displacement DNA polymerase, at least one inosine-containing primer and a nuclease that is capable of nicking DNA 3' to an inosine residue of the primer. The method is accomplished under an isothermal condition without denaturing the cDNA template. A method of quantifying RNA template in a sample and a method of detecting RNA template in a sample are also provided. Kits for amplifying deoxynucleic acid (DNA) from ribonucleic acid (RNA) template are also provided.

Description

[0001] Cross References to Related Applications [0002] This application claims priority to US Patent Application Nos. 13 / 538,955, filed June 29, 2012, and 13 / 538,962, filed June 29, 2012, the disclosures of which are incorporated herein by reference in their entirety. field of invention [0003] The present invention generally relates to methods for synthesizing deoxyribonucleic acid (DNA) by using reverse transcriptase, endonuclease and DNA in a single reaction starting from a ribonucleic acid (RNA) template, usually under isothermal conditions. polymerase to amplify the desired DNA. Background of the invention [0004] Nucleic acid amplification techniques are frequently used in nucleic acid-based assays for analyte detection, sensing, forensic and diagnostic applications, genome sequencing, whole genome amplification, and the like. These applications often require high specificity, sensitivity, accuracy and robustness of nucleic acid amplification techniques. Amplifi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P19/34
CPCC12Q1/6853C12Q2521/301C12Q2525/101C12Q2527/101C12Q2521/101C12Q2521/107C12Q2531/119C12Q2537/101
InventorJ. R. 尼尔森R. S. 杜蒂G. A. 格罗斯曼R. C. 赫勒
OwnerGLOBAL LIFE SCI SOLUTIONS OPERATIONS UK LTD