Chinese Simmental cattle fgf‑1 gene as a genetic marker of carcass meat quality
A technology of Simmental cattle and FGF-1, which is applied in the field of selective breeding of both meat and dairy cattle to achieve the effects of high accuracy, reliable molecular markers and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Obtaining bovine FGF-1 gene fragments and establishing a method for detecting polymorphisms in functional regions.
[0033] 1.1 Test material:
[0034] 449 28-month-old Chinese Simmental bulls came from Baolongshan beef cattle fattening farm in Tongliao City, Inner Mongolia. Jugular vein blood collection, all blood samples were 10 mL / head, anticoagulated with ACD anticoagulant, and frozen at -20°C. Genomic DNA was extracted from blood samples using a genomic DNA extraction kit.
[0035] 1.2 Primer design and PCR amplification:
[0036] The Chinese Simmental cattle were selected as the test material, and the following three pairs of primers were designed according to the bovine FGF-1 gene sequence:
[0037] P1 forward primer F: 5' TCCCTGGTTCAGAGTTCAAG 3',
[0038] P1 reverse primer R: 5' GGGTGTGGGTGCTGTTATC 3';
[0039] P2 forward primer F: 5' GTTCGTAGAGAGCCACAGATG3',
[0040] P2 reverse primer R: 5' ATCACTGTGCCAAAGGAAAT 3';
[0041] P3 forward primer F: 5' GTAGACGG...
Embodiment 2
[0051] Detection of polymorphism distribution of genetic markers obtained by screening in Chinese Simmental cattle population.
[0052] Detection of PCR-Xsp-Ⅰ-RFLP, PCR-Hae-III-RFLP and PCR-Rsa- of the second intron of FGF-1 gene in Chinese Simmental cattle -RFLP polymorphism distribution frequency. The test results showed that among the three genotypes of SNP1 (I2-8528 A>T), the proportion of wild-type AA individuals was high, and the proportion of mutant TT individuals was very low. The frequency distribution of allele A was significantly different, and the frequency of allele A was 0.77, which was the dominant gene. Among the three genotypes of SNP2 (I2-72251 A>C), the proportion of wild-type AA individuals was higher, and the proportion of mutant CC individuals was 0.045; the frequency of allele A was 0.75, which was the dominant gene. Among the three genes of SNP3 (I2-13970 A>T), mutant individuals were more dominant, the ratio of wild type was only 0.13, and the allel...
Embodiment 3
[0056] Association analysis and application of genetic markers of FGF-1 gene functional regions obtained by screening with carcass and meat quality traits of Chinese Simmental cattle.
[0057] Determination of traits: Carcass traits and meat quality traits studied include carcass weight, net meat percentage, hind leg circumference, hind leg width, hind leg length, thigh thickness, loin thickness, carcass length, carcass depth, carcass depth, backfat and carcass fat coverage, in vivo eye muscle area, and content of 14 unsaturated fatty acids between the longissimus dorsi muscles. The determination of all traits was performed according to the national standard GB / T1723821998.
[0058] In order to determine the correlation between the A 8528 T, A 72251 C, and A 13970 T mutation sites in the intron region of the FGF-1 gene and the carcass and meat quality traits of Chinese Simmental cattle, the PCR established in Example 1 - Xsp - I-RFLP, PCR-Hae-III-RFLP and PCR-Rsa- - RFLP me...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com