Fugu rubripes nervous necrosis virus capsid protein egg yolk antibody and application thereof
A technology of red-finned pufferfish and nerve necrosis, applied in the direction of antiviral immunoglobulins, antibodies, antiviral agents, etc., can solve the problems of restricting the commercialization of vaccines, low application value, inconvenient operation, etc., and achieve good immune protection. Potency, expression, sustained and stable, high titer effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1: Construction of the redfin puffer neuronecrosis virus capsid protein gene pGEX-5x-1-CP recombinant plasmid
[0021] Using the total RNA extracted from fish cells infected with redfin puffer neuronecrosis virus as a template, and using the downstream primer CP-NotI-BW:GATGCGGCCGCTTAGTTTCCCGAGTCAACCC, the capsid protein gene of redfin puffer neuronecrosis virus was generated by RT-PCR reaction. One-strand cDNA, the reagents for RT-PCR reaction are: reverse transcriptase, dNTP, buffer; the conditions are: 75°C, 5min; 42°C, 1 hour; 80°C, 10min. Subsequently, the obtained cDNA was used as a template, using the upstream primer CP-SalI-FW: 5'-GGTCGACTCATGGTACGCAAGGGTGATAAG-3' and the downstream primer CP-NotI-BW: GATGCGGCCGCTTAGTTTCCCGAGTCAACCC, PCR amplification obtained double-stranded DNA. The reagents for the PCR reaction are: high-fidelity DNA polymerase, dNTP, and buffer; the PCR amplification reaction conditions are: pre-denaturation at 95°C for 5 minutes; fo...
Embodiment 2
[0022] Embodiment 2: Expression of recombinant plasmid pGEX-5x-1-CP in Escherichia coli
[0023] The pGEX-5X-1-CP recombinant plasmid was transformed into Escherichia coli, and the next day, a single colony on the transformation plate was selected and placed in LB liquid medium containing ampicillin, and cultured on a constant temperature shaker at 37°C and 200 rpm. When the OD value of the bacilli reaches 0.4-0.6, add IPTG with a final concentration of 1 mmol / L, and induce at 25-37°C for 4-8 hours. Centrifuge at 6000rpm for 10min to collect the bacteria. The bacteria were crushed under high pressure, and the broken suspension was centrifuged at 12,000 rpm for 10 minutes at 4°C, and the supernatant and precipitate were collected respectively. Use inclusion body purification technology to extract a large amount of protein from the collected precipitate. The specific steps are as follows:
[0024] (1) Suspend the pellet in 20mL buffer A (50mM Tris-HCl, 5mM EDTA, pH 8.0), mix w...
Embodiment 3
[0029] Example 3: Preparation of egg yolk antibody to redfin puffer neuronecrosis virus
[0030]1. Antigen preparation: fully emulsify the recombinant protein with an equal volume of adjuvant (after fully emulsifying, put the emulsified product in water to see if it disperses, if it does not disperse, it means that the emulsification is sufficient), the first immunization injection is recombined with GST-CP A vaccine emulsified with protein and an equal volume of complete Freund's adjuvant, and a vaccine emulsified with GST-CP recombinant protein and incomplete Freund's adjuvant for the second and third immunization injections.
[0031] 2. Immunization: Select 10 healthy hens, take 1ml of the vaccine and inject 0.25ml at each point into the hen’s wings and breast muscles on both sides, and immunize once every 2 weeks. The specific immunization procedures are shown in Table 1 below. Begin to collect eggs, store them at 4°C for later use, and select eggs before immunization as n...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
