Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fugu rubripes nervous necrosis virus capsid protein egg yolk antibody and application thereof

A technology of red-finned pufferfish and nerve necrosis, applied in the direction of antiviral immunoglobulins, antibodies, antiviral agents, etc., can solve the problems of restricting the commercialization of vaccines, low application value, inconvenient operation, etc., and achieve good immune protection. Potency, expression, sustained and stable, high titer effect

Active Publication Date: 2015-06-24
HUAZHONG AGRI UNIV +1
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there is no commercially available vaccine
Patent CN200410027186 discloses a recombinant protein vaccine of neuronecrosis virus, but the vaccine has the following disadvantages: (1) the neuronecrosis virus infects fish in the juvenile stage, and juveniles do not have the ability to produce antibodies at this time, so this type of vaccine It cannot be used in the juvenile fish stage, so the application value is not great; (2) This vaccine needs to be immunized by injection. Compared with humans and livestock, because the fry are small and live in water, the injection immunization method is time-consuming and inconvenient to operate , thus greatly limiting the commercialization of the vaccine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fugu rubripes nervous necrosis virus capsid protein egg yolk antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1: Construction of the redfin puffer neuronecrosis virus capsid protein gene pGEX-5x-1-CP recombinant plasmid

[0021] Using the total RNA extracted from fish cells infected with redfin puffer neuronecrosis virus as a template, and using the downstream primer CP-NotI-BW:GATGCGGCCGCTTAGTTTCCCGAGTCAACCC, the capsid protein gene of redfin puffer neuronecrosis virus was generated by RT-PCR reaction. One-strand cDNA, the reagents for RT-PCR reaction are: reverse transcriptase, dNTP, buffer; the conditions are: 75°C, 5min; 42°C, 1 hour; 80°C, 10min. Subsequently, the obtained cDNA was used as a template, using the upstream primer CP-SalI-FW: 5'-GGTCGACTCATGGTACGCAAGGGTGATAAG-3' and the downstream primer CP-NotI-BW: GATGCGGCCGCTTAGTTTCCCGAGTCAACCC, PCR amplification obtained double-stranded DNA. The reagents for the PCR reaction are: high-fidelity DNA polymerase, dNTP, and buffer; the PCR amplification reaction conditions are: pre-denaturation at 95°C for 5 minutes; fo...

Embodiment 2

[0022] Embodiment 2: Expression of recombinant plasmid pGEX-5x-1-CP in Escherichia coli

[0023] The pGEX-5X-1-CP recombinant plasmid was transformed into Escherichia coli, and the next day, a single colony on the transformation plate was selected and placed in LB liquid medium containing ampicillin, and cultured on a constant temperature shaker at 37°C and 200 rpm. When the OD value of the bacilli reaches 0.4-0.6, add IPTG with a final concentration of 1 mmol / L, and induce at 25-37°C for 4-8 hours. Centrifuge at 6000rpm for 10min to collect the bacteria. The bacteria were crushed under high pressure, and the broken suspension was centrifuged at 12,000 rpm for 10 minutes at 4°C, and the supernatant and precipitate were collected respectively. Use inclusion body purification technology to extract a large amount of protein from the collected precipitate. The specific steps are as follows:

[0024] (1) Suspend the pellet in 20mL buffer A (50mM Tris-HCl, 5mM EDTA, pH 8.0), mix w...

Embodiment 3

[0029] Example 3: Preparation of egg yolk antibody to redfin puffer neuronecrosis virus

[0030]1. Antigen preparation: fully emulsify the recombinant protein with an equal volume of adjuvant (after fully emulsifying, put the emulsified product in water to see if it disperses, if it does not disperse, it means that the emulsification is sufficient), the first immunization injection is recombined with GST-CP A vaccine emulsified with protein and an equal volume of complete Freund's adjuvant, and a vaccine emulsified with GST-CP recombinant protein and incomplete Freund's adjuvant for the second and third immunization injections.

[0031] 2. Immunization: Select 10 healthy hens, take 1ml of the vaccine and inject 0.25ml at each point into the hen’s wings and breast muscles on both sides, and immunize once every 2 weeks. The specific immunization procedures are shown in Table 1 below. Begin to collect eggs, store them at 4°C for later use, and select eggs before immunization as n...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of biotechnologies, and particularly relates to a fugu rubripes nervous necrosis virus capsid protein egg yolk antibody and an application of the egg yolk antibody. The egg yolk antibody is prepared by a method comprising the following steps that: a fugu rubripes nervous necrosis virus capsid protein gene is recombined to a GST (Glutathione S-Transferase) fusion gene expression vector pGEX-5x-1; a pGEX-5x-1-CP recombinant plasmid is constructed and transformed into escherichia coli, and induces a fusion gene to express; a GST-CP recombinant protein is obtained by extraction and purification with an inclusion body purification technology; a hen is immunized by the GST-CP recombinant protein; a hen egg is collected; and the egg yolk antibody is extracted from the hen egg. The prepared egg yolk antibody can effectively inhibit a fugu rubripes nervous necrosis virus, is high in titer, has good immune protection efficacy, and can serve as a nervous necrosis virus vaccine to be added to fish feed in a juvenile fish period of fish.

Description

field of invention [0001] The invention belongs to the field of biological technology, and in particular relates to a yolk antibody to capsid protein of redfin puffer neuronecrosis virus and an application thereof. technical background [0002] Nervous necrosis virus (NNV) is a fish pathogen that is prevalent worldwide. It is prevalent in mainland China, Taiwan, Japan, Australia, the United Kingdom, Canada, Norway and other countries and regions. It can cause more than 30 species of Juveniles, larvae and even grouper adults of important economic fish die on a large scale, seriously endangering the healthy breeding of fish. The study of this viral disease is a research hotspot of international aquatic diseases. The neuronecrosis virus belongs to the Nodaviridae family (Nodaviridae) and the Beta Nodavirus genus (Betanodavirus) in classification. Virus particles are about 30-40 nanometers in diameter, icosahedral, and have no envelope. Neuronecrosis virus is a single positiv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/10C07K16/02A61K39/395A61P31/14
Inventor 林蠡伊丽竹秦真东周洋兰江风邓俊杰谭锐敏
Owner HUAZHONG AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More