Supercharge Your Innovation With Domain-Expert AI Agents!

Application of MicroRNA26b-3p inhibitor in preparation of human umbilical cord derived mesenchymal stem cell

1. The technology of microrna26b-3p and mesenchymal stem cells is applied in the direction of cells modified by introducing foreign genetic material, DNA/RNA fragments, recombinant DNA technology, etc., and can solve the problems of stem cell research and application.

Active Publication Date: 2015-06-24
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are more and more studies on microRNA and cell function, there are no literature reports on the research and application of MicroRNA26b-3p on human umbilical cord-derived mesenchymal stem cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of MicroRNA26b-3p inhibitor in preparation of human umbilical cord derived mesenchymal stem cell
  • Application of MicroRNA26b-3p inhibitor in preparation of human umbilical cord derived mesenchymal stem cell
  • Application of MicroRNA26b-3p inhibitor in preparation of human umbilical cord derived mesenchymal stem cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1: Human umbilical cord-derived mesenchymal stem cells overexpress MicroRNA26b-3p mimicus and Inhibitor

[0045] 1. Recovery of human umbilical cord-derived mesenchymal stem cells

[0046] Take hUMSC out of the liquid nitrogen storage tank and shake in a 37°C water bath until dissolved. Centrifuge at 1000rpm for 5min, discard the supernatant, add 1ml of FBS-containing DMEM (L) culture medium to suspend the cells, transfer to a T25 culture flask, and add culture medium to 5ml. Place at 37°C, 5% CO 2 Incubate in an incubator and change the culture medium every 3 days.

[0047] 2. Cell transfection

[0048] 1. Transfect MicroRNA26b-3p mimicus and Inhibitor. (purchased from Shanghai Gemma Gene Chemical Technology Co., Ltd., which is a small RNA fragment that can up-regulate or down-regulate the expression of MicroRNA26b-3p in hUMSC), and the transfection reagent used Invitrogen RNAimax Reagent, cells were transfected according to the company's guidelines.

[...

Embodiment 2

[0070] Example 2: Using EdU incorporation experiments to study the proliferation characteristics of ov26b-hUMSC and in26b-hUMSC

[0071] Take hUMSCs in good growth state and lay them in 48 wells. When the cells grow to 50% polymerization degree, transfect hUMSCs according to the above method, and incubate in the incubator for 48 hours, use the EdU kit to detect the proliferation of the cells, where the EdU reagent The box was purchased from Ruibo Biotechnology Co., Ltd., and all steps were carried out in strict accordance with the instructions of this product.

[0072] Observed under a fluorescence microscope, the experimental results are as follows figure 2 shown.

[0073] The experimental results showed that compared with the EdU incorporation fluorescence of the control group (nc group) in Figure C, the results in Figure A showed that the EdU incorporation rate of ov26b-hUMSC was significantly reduced, and the results in Figure B showed that the in26b-hUMSC EdU incorporat...

Embodiment 3

[0074] Example 3, MicroRNA26b-3p can negatively regulate the expression of ESR1

[0075] 1. RT-PCR detection of the expression level of ESR1mRNA

[0076] The total RNA of the four groups of cells obtained above was extracted by RNAiso Reagent (TAKALA), and reverse transcribed into cDNA. Primers were designed to detect the expression level of ESR1mRNA. GAPDH was used as an internal reference for detection. nc-hUMSC and innc-hUMSC were used as controls.

[0077] The primer sequences are as follows:

[0078] The primers for ESR1 are as follows:

[0079] Forward primer: 5'ATGAAAGGGATACGAAAAGACCG3' (SEQ ID NO: 10)

[0080] Reverse primer: 5'TTGGCAGCTCTCATGTCTCC3' (SEQ ID NO: 11)

[0081] The primers for GAPDH are as follows:

[0082] Forward primer: 5'GGCCTCCAAGGAGTAAGACC3' (SEQ ID NO: 12)

[0083] Reverse primer: 5'AGGGGTCTACATGGCAACTG3' (SEQ ID NO: 13)

[0084] The result is as image 3 As shown, it can be seen that the mRNA expression of ESR1 was decreased in ov26b-hUM...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology and provides application of a MicroRNA26b-3p inhibitor in preparation of a reagent for promoting proliferation of a human umbilical cord derived mesenchymal stem cell. The reagent comprises but is not limited to: (1) a MicroRNA26b-3p inhibitor, (2) a recombinant vector containing a MicroRNA26b-3p inhibitor coding gene, (3) recombinant virus containing the MicroRNA26b-3p inhibitor coding gene, and (4) a recombinant virus vector containing the MicroRNA26b-3p inhibitor coding gene. Experiments prove that the MicroRNA26b-3p inhibitor can be used for improving the expression of an estrogen receptor and remarkably increasing the proliferation speed of the human umbilical cord derived mesenchymal stem cell. The application disclosed by the invention provides new conception and method for rapidly proliferating the human umbilical cord derived mesenchymal stem cell and obtaining regenerative medical mesenchymal stem cell for clinical application more quickly.

Description

technical field [0001] The present invention relates to the field of biotechnology, in particular to the application of a MicroRNA26b-3p inhibitor in the preparation of human umbilical cord-derived mesenchymal stem cells, that is, a method for promoting the proliferation of human umbilical cord-derived mesenchymal stem cells, and the method Applied to the preparation of tissue engineering cells. Background technique [0002] Mesenchymal stem cells (MSCs) are stem cells remaining in adult tissues, with unlimited expansion and multidirectional differentiation capabilities. Due to the convenient acquisition of MSC cells, low immunogenicity, no ethical disputes, and secreted nutritional factors, they can Suppresses immune response, promotes blood vessel formation, nourishes peripheral cells, and is expected to be an exciting seed cell in regenerative medicine. In 2011, a data on the NIH official website listed 19,364 cases of cell therapy, of which 206 were related to MSC cells...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/88C12N15/86C12N15/85C12N15/113C12N5/10
Inventor 刘厚奇王巧玲徐辰王越仵敏娟
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More