Application of MicroRNA26b-3p inhibitor in preparation of human umbilical cord derived mesenchymal stem cell
1. The technology of microrna26b-3p and mesenchymal stem cells is applied in the direction of cells modified by introducing foreign genetic material, DNA/RNA fragments, recombinant DNA technology, etc., and can solve the problems of stem cell research and application.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1: Human umbilical cord-derived mesenchymal stem cells overexpress MicroRNA26b-3p mimicus and Inhibitor
[0045] 1. Recovery of human umbilical cord-derived mesenchymal stem cells
[0046] Take hUMSC out of the liquid nitrogen storage tank and shake in a 37°C water bath until dissolved. Centrifuge at 1000rpm for 5min, discard the supernatant, add 1ml of FBS-containing DMEM (L) culture medium to suspend the cells, transfer to a T25 culture flask, and add culture medium to 5ml. Place at 37°C, 5% CO 2 Incubate in an incubator and change the culture medium every 3 days.
[0047] 2. Cell transfection
[0048] 1. Transfect MicroRNA26b-3p mimicus and Inhibitor. (purchased from Shanghai Gemma Gene Chemical Technology Co., Ltd., which is a small RNA fragment that can up-regulate or down-regulate the expression of MicroRNA26b-3p in hUMSC), and the transfection reagent used Invitrogen RNAimax Reagent, cells were transfected according to the company's guidelines.
[...
Embodiment 2
[0070] Example 2: Using EdU incorporation experiments to study the proliferation characteristics of ov26b-hUMSC and in26b-hUMSC
[0071] Take hUMSCs in good growth state and lay them in 48 wells. When the cells grow to 50% polymerization degree, transfect hUMSCs according to the above method, and incubate in the incubator for 48 hours, use the EdU kit to detect the proliferation of the cells, where the EdU reagent The box was purchased from Ruibo Biotechnology Co., Ltd., and all steps were carried out in strict accordance with the instructions of this product.
[0072] Observed under a fluorescence microscope, the experimental results are as follows figure 2 shown.
[0073] The experimental results showed that compared with the EdU incorporation fluorescence of the control group (nc group) in Figure C, the results in Figure A showed that the EdU incorporation rate of ov26b-hUMSC was significantly reduced, and the results in Figure B showed that the in26b-hUMSC EdU incorporat...
Embodiment 3
[0074] Example 3, MicroRNA26b-3p can negatively regulate the expression of ESR1
[0075] 1. RT-PCR detection of the expression level of ESR1mRNA
[0076] The total RNA of the four groups of cells obtained above was extracted by RNAiso Reagent (TAKALA), and reverse transcribed into cDNA. Primers were designed to detect the expression level of ESR1mRNA. GAPDH was used as an internal reference for detection. nc-hUMSC and innc-hUMSC were used as controls.
[0077] The primer sequences are as follows:
[0078] The primers for ESR1 are as follows:
[0079] Forward primer: 5'ATGAAAGGGATACGAAAAGACCG3' (SEQ ID NO: 10)
[0080] Reverse primer: 5'TTGGCAGCTCTCATGTCTCC3' (SEQ ID NO: 11)
[0081] The primers for GAPDH are as follows:
[0082] Forward primer: 5'GGCCTCCAAGGAGTAAGACC3' (SEQ ID NO: 12)
[0083] Reverse primer: 5'AGGGGTCTACATGGCAACTG3' (SEQ ID NO: 13)
[0084] The result is as image 3 As shown, it can be seen that the mRNA expression of ESR1 was decreased in ov26b-hUM...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap