Double-PCR (polymerase chain reaction) molecular detection primer for tobacco phytophthora parasitica and thielaviopsis basicola and detection method
A technology of tobacco black shank and root black rot fungus, applied in the direction of microbial-based methods, biochemical equipment and methods, microbial measurement/inspection, etc., can solve troublesome, labor-intensive, time-consuming, non-specific and highly sensitive Sexual system and other issues to achieve the effect of improving the level of prevention and control
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] A double PCR molecular detection primer of tobacco black shank bacteria and root black rot bacteria, the primer pair is as follows:
[0028] YYI-F: TCATTACCACACCTAAAAAACT,
[0029] YYI-R: ACTTTCGTCCCCACAGTATATT;
[0030] TB1419-F: GTGTTGGAGGACCCGCGTTTAG,
[0031] TB1419-R: AGTTGAGGGTTTTTCGGCATGTT.
[0032] The specificity identification test of primer of the present invention:
[0033] (1) Genomic DNA of tobacco root black rot fungus 50ng / μL, genomic DNA of black shank fungus 50ng / μL, and the same concentration of tobacco rubella, tobacco cinerea, tobacco frogeye, tobacco leaves, tobacco gray spot Genomic DNA of pathogens and Fusarium as templates, using the primers of the present invention for PCR amplification, using a 20 μL reaction system, including: 0.2 μL of 5u / μL rTaq enzyme, each 0.4 μL of 10 μmol / L YYI-F , YYI-R, TB1419-F and TB1419-R primers, 1 μL of total DNA, 1.5 μL of 2.5 mmol / L dNTPs, 1.0 μL of 2.5 mmol / L MgCl 2 Solution, 2μL of 10×PCR Buffer, the b...
Embodiment 2
[0038] A double PCR molecular detection method of tobacco black shank bacteria and root black rot bacteria, comprising the following steps:
[0039](1) Extract the total DNA of soil samples from the soil of different tobacco fields: soil sample DNA1, soil sample DNA2, soil sample DNA3, soil sample DNA4, soil sample DNA5, soil sample DNA6, soil sample DNA7;
[0040] (2) Using 50 ng / μL of mixed DNA of tobacco black shank bacteria and root black rot bacteria, and the above-mentioned total DNA as a template, PCR amplification was performed with the primers in Example 1, and a 20 μL reaction system was used, including: 0.2 μL of 5u / μL rTaq enzyme, 0.4 μL each of 10 μmol / L YYI-F, YYI-R, TB1419-F and TB1419-R primers, 1 μL of total DNA, 1.5 μL of 2.5 mmol / L dNTP, 1.0 μL of 2.5 mmol / L L MgCl 2 Solution, 2μL of 10×PCR Buffer, the balance is ddH 2 O; PCR amplification program: pre-denaturation at 95°C for 4 min, 35 cycles of denaturation at 95°C for 30 s, annealing at 59°C for 50 s, ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 