Double-PCR (polymerase chain reaction) molecular detection primer for tobacco phytophthora parasitica and thielaviopsis basicola and detection method

A technology of tobacco black shank and root black rot fungus, applied in the direction of microbial-based methods, biochemical equipment and methods, microbial measurement/inspection, etc., can solve troublesome, labor-intensive, time-consuming, non-specific and highly sensitive Sexual system and other issues to achieve the effect of improving the level of prevention and control

Inactive Publication Date: 2015-06-24
HENAN AGRICULTURAL UNIVERSITY
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, tobacco black shank and root black rot are two kinds of soil-borne fungi that often occur together, and a single detection will inevitably cause a lot of tr

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double-PCR (polymerase chain reaction) molecular detection primer for tobacco phytophthora parasitica and thielaviopsis basicola and detection method
  • Double-PCR (polymerase chain reaction) molecular detection primer for tobacco phytophthora parasitica and thielaviopsis basicola and detection method
  • Double-PCR (polymerase chain reaction) molecular detection primer for tobacco phytophthora parasitica and thielaviopsis basicola and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] A double PCR molecular detection primer of tobacco black shank bacteria and root black rot bacteria, the primer pair is as follows:

[0028] YYI-F: TCATTACCACACCTAAAAAACT,

[0029] YYI-R: ACTTTCGTCCCCACAGTATATT;

[0030] TB1419-F: GTGTTGGAGGACCCGCGTTTAG,

[0031] TB1419-R: AGTTGAGGGTTTTTCGGCATGTT.

[0032] The specificity identification test of primer of the present invention:

[0033] (1) Genomic DNA of tobacco root black rot fungus 50ng / μL, genomic DNA of black shank fungus 50ng / μL, and the same concentration of tobacco rubella, tobacco cinerea, tobacco frogeye, tobacco leaves, tobacco gray spot Genomic DNA of pathogens and Fusarium as templates, using the primers of the present invention for PCR amplification, using a 20 μL reaction system, including: 0.2 μL of 5u / μL rTaq enzyme, each 0.4 μL of 10 μmol / L YYI-F , YYI-R, TB1419-F and TB1419-R primers, 1 μL of total DNA, 1.5 μL of 2.5 mmol / L dNTPs, 1.0 μL of 2.5 mmol / L MgCl 2 Solution, 2μL of 10×PCR Buffer, the b...

Embodiment 2

[0038] A double PCR molecular detection method of tobacco black shank bacteria and root black rot bacteria, comprising the following steps:

[0039](1) Extract the total DNA of soil samples from the soil of different tobacco fields: soil sample DNA1, soil sample DNA2, soil sample DNA3, soil sample DNA4, soil sample DNA5, soil sample DNA6, soil sample DNA7;

[0040] (2) Using 50 ng / μL of mixed DNA of tobacco black shank bacteria and root black rot bacteria, and the above-mentioned total DNA as a template, PCR amplification was performed with the primers in Example 1, and a 20 μL reaction system was used, including: 0.2 μL of 5u / μL rTaq enzyme, 0.4 μL each of 10 μmol / L YYI-F, YYI-R, TB1419-F and TB1419-R primers, 1 μL of total DNA, 1.5 μL of 2.5 mmol / L dNTP, 1.0 μL of 2.5 mmol / L L MgCl 2 Solution, 2μL of 10×PCR Buffer, the balance is ddH 2 O; PCR amplification program: pre-denaturation at 95°C for 4 min, 35 cycles of denaturation at 95°C for 30 s, annealing at 59°C for 50 s, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a double-PCR (polymerase chain reaction) molecular detection primer for tobacco phytophthora parasitica and thielaviopsis basicola and a detection method. The detection primer comprises YYI-F: TCATTACCACACCTAAAAAACT, YYI-R: ACTTTCGTCCCCACAGTATATT, TB1419-F: GTGTTGGAGGACCCGCGTTTAG and TB1419-R: AGTTGAGGGTTTTTCGGCATGTT. The detection method comprises the steps of performing extraction on total DNA, PCR amplification and gel electrophoresis under certain conditions. According to the detection primer and the detection method provided by the invention, a specific and high-sensitivity double-PCR molecular detection system for the tobacco phytophthora parasitica and thielaviopsis basicola is established, and by detecting the total DNA sequences of materials including tobacco diseased plants, soil and the like, the quick, accurate and ultralow-concentration once double-identification of the tobacco phytophthora parasitica and thielaviopsis basicola is finished.

Description

technical field [0001] The invention belongs to the field of plant disease and insect pest quarantine, and in particular relates to a double PCR molecular detection primer and a detection method for tobacco black shank pathogen and root black rot pathogen. Background technique [0002] Tobacco is a crop that pays equal attention to both yield and quality, especially quality. Scientific pest control is the key to ensuring the normal growth and development of tobacco and achieving high quality and high yield. Tobacco black shank and root black rot (two black diseases of tobacco) are worldwide diseases. These two diseases often occur together. Smoking areas are more serious, and the incidence rate of serious plots can reach more than 30%. Tobacco-producing areas such as Shandong, Henan, Anhui, Jilin, and Fujian have also occurred, and in recent years there has been a tendency of aggravating the harm. However, tobacco black shank and root black rot are two kinds of soil-borne ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/77
CPCC12Q1/686C12Q2537/143
Inventor 郑文明李淑君封松利蒋士君邢国珍申一林宋鹏宇王海涛
Owner HENAN AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap