In Situ Quantification of Protein–Protein Interactions in Living Cells by Fluorescence Resonance Energy Transfer
A fluorescence resonance energy, fluorescent protein technology, applied in the field of protein interaction, can solve the problems of weakening fluorescent protein quenching, cell size, phototoxicity, and only one time resolution, saving experimental costs and accurate measurement values. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0083] Example 1 (dsFRET feasibility)
[0084] The feasibility of dsFRET was demonstrated by the dimerization and co-expression experiments of Dronpa and rsTagRFP.
[0085] 1. Experimental method:
[0086] Both Dronpa and rsTagRFP (Transmembrane Signal Transduction Laboratory, School of Medicine, Tsinghua University) are existing reversible photoswitchable fluorescent proteins. We will use the DNA sequence of the target fragment (ie, the DNA sequence shown in SEQ ID NO: 1 and 2) The PCR method was used to connect to the eukaryotic vector pcDNA3.1.
[0087]The two target fragments of Dronpa and rsTagRFP were connected according to the traditional FRET dimer CFP-YFP, and a base sequence of TCCGGACTCAGATCT was added in the middle, and Dronpa and rsTagRFP were connected and connected to the eukaryotic vector pcDNA3.1.
[0088] In the cell experiment, we used the transfection reagent lipo2000 for transfection, and the vector was transfected into HEK293T cells. 24-48 hours after ...
Embodiment 2
[0092] Embodiment 2 (two-hybrid experiment)
[0093] Using the dsFRET method, using figure 2 The shown dsFRET imaging device detects the interaction between Dronpa-labeled ICDI protein and rsTagRFP-labeled PreIQ3-IQD-AD protein in a two-hybrid experiment, wherein the DNA sequence of ICDI protein is as follows:
[0094] ctgcacgtgcctggaacccactcggaccccagccatgggaagaggggcagtgccgacagcttggtggaggctgtgcttatctcagagggtctgggcctctttgctcgagacccacgtttcgtggccctggccaagcaggagattgcagatgcgtgtcgcctgacgctggatgagatggacaatgctgccagtgacctgctggcacagggaaccagctctctctatagcgacgaggagtccatcctctcccgcttcgatgaggaggacttgggagacgagatggcctgcgtccacgccctc(SEQ IDNO:3)
[0095] The DNA sequence of the Pre-IQ3-AD protein is as follows:
[0096] atcaagactgaaggcaacctggagcaagctaatgaagagctccgcgctgtgataaagaaaatctggaagaagacaagcatgaagctacttgaccaagttgtccctccagctggtgatgatgaggtaaccgtggggaagttctatgccactttcctgatacaggactactttaggaaattcaagaagcggaaagagcaaggcctggtggggaaataccctgcgaagaacaccacgatcgccctacaggcgggattaaggaccctgcatgacattgggcca...
Embodiment 3
[0104] Embodiment 3 (subcellular level cell imaging)
[0105] dsFRET provides a means of FRET subcellular imaging, using the dsFRET method, using figure 2 The shown dsFRET imaging device detects HEK293T cells, and the results are as follows Figure 15 , Figure 16 shown in Figure 15 , the first column represents the Dronpa channel map of cells when rsTagRFP is off; the second column represents the rsTagRFP channel map of cells when Dronpa is off; the third column represents the distribution of dsFRET FR at the subcellular level. exist Figure 16In the above, the FR at the cell membrane is taken from the average value of three consecutive pixel points of the maximum average value at the cell membrane on one trajectory line of the cell; the FR at the cytoplasm is taken from the average value of dozens of pixel points at the cytoplasm on the same trajectory line of the cell . All experimental steps are consistent with the previous steps, and when calculating FRET values, p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


