Unlock instant, AI-driven research and patent intelligence for your innovation.

In Situ Quantification of Protein–Protein Interactions in Living Cells by Fluorescence Resonance Energy Transfer

A fluorescence resonance energy, fluorescent protein technology, applied in the field of protein interaction, can solve the problems of weakening fluorescent protein quenching, cell size, phototoxicity, and only one time resolution, saving experimental costs and accurate measurement values. Effect

Active Publication Date: 2017-06-23
TSINGHUA UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, the commonly used FRET methods still have various defects. For example, acceptor photobleaching FRET (apFRET) is a self-contrasted FRET measurement method, which is currently a relatively accurate FRET efficiency quantitative technique.
But its shortcoming is that it has great phototoxicity to cells, it can only be done once and the time resolution is poor (usually several minutes); pcFRET is a technology that combines photoswitchable fluorophores with apFRET. method, the fluorescence intensity of the donor oscillates with the photoswitching of the acceptor, which retains the accuracy characteristics of apFRET efficiency calculation, and at the same time, compared with apFRET, it greatly reduces the imaging time (~10 seconds), making the calculation more efficient. Reproducibility, reduced phototoxicity to cells, and reduced quenching of fluorescent proteins, but pcFRET is not suitable as a quantitative tool for two-hybrid FRET

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • In Situ Quantification of Protein–Protein Interactions in Living Cells by Fluorescence Resonance Energy Transfer
  • In Situ Quantification of Protein–Protein Interactions in Living Cells by Fluorescence Resonance Energy Transfer
  • In Situ Quantification of Protein–Protein Interactions in Living Cells by Fluorescence Resonance Energy Transfer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] Example 1 (dsFRET feasibility)

[0084] The feasibility of dsFRET was demonstrated by the dimerization and co-expression experiments of Dronpa and rsTagRFP.

[0085] 1. Experimental method:

[0086] Both Dronpa and rsTagRFP (Transmembrane Signal Transduction Laboratory, School of Medicine, Tsinghua University) are existing reversible photoswitchable fluorescent proteins. We will use the DNA sequence of the target fragment (ie, the DNA sequence shown in SEQ ID NO: 1 and 2) The PCR method was used to connect to the eukaryotic vector pcDNA3.1.

[0087]The two target fragments of Dronpa and rsTagRFP were connected according to the traditional FRET dimer CFP-YFP, and a base sequence of TCCGGACTCAGATCT was added in the middle, and Dronpa and rsTagRFP were connected and connected to the eukaryotic vector pcDNA3.1.

[0088] In the cell experiment, we used the transfection reagent lipo2000 for transfection, and the vector was transfected into HEK293T cells. 24-48 hours after ...

Embodiment 2

[0092] Embodiment 2 (two-hybrid experiment)

[0093] Using the dsFRET method, using figure 2 The shown dsFRET imaging device detects the interaction between Dronpa-labeled ICDI protein and rsTagRFP-labeled PreIQ3-IQD-AD protein in a two-hybrid experiment, wherein the DNA sequence of ICDI protein is as follows:

[0094] ctgcacgtgcctggaacccactcggaccccagccatgggaagaggggcagtgccgacagcttggtggaggctgtgcttatctcagagggtctgggcctctttgctcgagacccacgtttcgtggccctggccaagcaggagattgcagatgcgtgtcgcctgacgctggatgagatggacaatgctgccagtgacctgctggcacagggaaccagctctctctatagcgacgaggagtccatcctctcccgcttcgatgaggaggacttgggagacgagatggcctgcgtccacgccctc(SEQ IDNO:3)

[0095] The DNA sequence of the Pre-IQ3-AD protein is as follows:

[0096] atcaagactgaaggcaacctggagcaagctaatgaagagctccgcgctgtgataaagaaaatctggaagaagacaagcatgaagctacttgaccaagttgtccctccagctggtgatgatgaggtaaccgtggggaagttctatgccactttcctgatacaggactactttaggaaattcaagaagcggaaagagcaaggcctggtggggaaataccctgcgaagaacaccacgatcgccctacaggcgggattaaggaccctgcatgacattgggcca...

Embodiment 3

[0104] Embodiment 3 (subcellular level cell imaging)

[0105] dsFRET provides a means of FRET subcellular imaging, using the dsFRET method, using figure 2 The shown dsFRET imaging device detects HEK293T cells, and the results are as follows Figure 15 , Figure 16 shown in Figure 15 , the first column represents the Dronpa channel map of cells when rsTagRFP is off; the second column represents the rsTagRFP channel map of cells when Dronpa is off; the third column represents the distribution of dsFRET FR at the subcellular level. exist Figure 16In the above, the FR at the cell membrane is taken from the average value of three consecutive pixel points of the maximum average value at the cell membrane on one trajectory line of the cell; the FR at the cytoplasm is taken from the average value of dozens of pixel points at the cytoplasm on the same trajectory line of the cell . All experimental steps are consistent with the previous steps, and when calculating FRET values, p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for determining whether interaction exists between first protein and second protein in a cell with an FRET (fluorescence resonance energy transfer) method. The method comprises the following steps: (1), first fusion protein and second fusion protein are expressed in the cell, wherein the first fusion protein comprises the first protein and first closable fluorescent protein serving as a donor, and the second fusion protein comprises the second protein and second closable fluorescent protein serving as a receptor; (2), under the 3 conditions that the first closable fluorescent protein and the second closable fluorescent protein are open, the first closable fluorescent protein is open independently and the second closable fluorescent protein is open independently, the fluorescence values of the cell are detected under the conditions of three types of exciting light and emitted light respectively, so that a data set comprising fluorescence absolute values can be acquired; (3), the value of a parameter FR is determined on the basis of the data set, and whether the interaction exists between the first protein and the second protein is determined on the basis of the obtained value of the parameter FR.

Description

technical field [0001] The present invention relates to the field of biotechnology, in particular to a method for protein interaction, and more specifically to a method for determining whether there is interaction between a first protein and a second protein in a cell by means of fluorescence resonance energy transfer. Background technique [0002] Resonance energy transfer (RET: resonance energy transfer) was first discovered by scientist Forster in 1948, so it is called FRET (Forster resonance energy transfer). Meanwhile, since the acceptor is usually a fluorescent molecule, FRET is also often interpreted as fluorescence resonance energy transfer. Fluorescent protein FRET has high specificity and sensitivity in the study of intermolecular interactions at the level of the living body (living cells), making it an important research tool and method in the field of life sciences. [0003] However, the currently commonly used FRET methods still have various defects. For exampl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N21/64
Inventor 刘晓冬唐吉王颖奇
Owner TSINGHUA UNIV