Kit for detecting tert gene promoter mutation and detection method thereof
A promoter and kit technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., to achieve the effect of strong specificity, high sensitivity, clear and objective interpretation of results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] The quality control product involved in the present invention is made up of positive plasmid and negative genome DNA corresponding to TERT gene promoter C228T, C228A, CC242-243TT, C250T, and negative genome DNA is unmutated human blood genome DNA, and its concentration is 10 3 Copy number; the positive plasmid is a mutant sequence containing a mutation site, which was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and connected to the pUC57-Amp vector. After DNA extraction and purification, it was diluted to a concentration of 10 3 Copy number, get positive plasmid. The above mutation site information comes from the NCBI-OMIM database, and the specific mutation sequence is as follows:
[0036] C228T:
[0037] gcgggcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggacccccgccccgtcccgaccccctcccgggtccccggcccagcccc tccgggccctccccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagc...
Embodiment 2
[0066] The minimum detection limit of the four mutation sites of TERT gene promoter was analyzed by using the optimized detection system and reaction program.
[0067] The research on the minimum detection limit mainly includes the following two aspects: 1) The research on the minimum detection limit of the mutation ratio: the ratio of the lowest mutation DNA that can be detected under a certain DNA concentration. 2) Research on the minimum detection limit of DNA concentration: the minimum DNA concentration that can be detected under a certain mutation ratio.
[0068] 1) Research on the minimum detection limit of mutation ratio
[0069] Firstly, accurately dilute the TERT promoter mutation positive quality control product and the Control quality control product, and uniformly dilute to 10 3 For copy number, the dilution is 10 ng / μl of wild-type DNA. After mixing the positive quality control with 10ng / ul negative genome according to the volume ratio of 0:100, 0.01:99.99, 0.5:...
Embodiment 3
[0088] Collect 10 tissue samples and matching urine samples from patients with bladder cancer. After the samples are collected, they are immediately stored in a -80 degree refrigerator. DNA in tissue samples and free DNA (cf-DNA) in urine were extracted using Qiagen kits, and subjected to agarose gel electrophoresis and concentration determination.
[0089] Then, the method of Example 1 was used to detect the mutation sites in the tissue samples and urine samples of 10 cases, and the tissue samples were sequenced at the same time, and the results are shown in Table 7.
[0090] Table 7. Results of colorectal cancer patients detected by the method of the present invention
[0091]
[0092] Note: "-" means that the sample has no amplification curve at this site or the sequencing result is negative
[0093] The results show that the coincidence rate of mutations in urine samples detected by the method of the present invention and the urine samples detected by the sequencing me...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


