Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of method for biotransformation of Polygonin using thermostable β-glucosidase and its mutants

A technology of glucosidase and mutant, which is applied in the fields of biochemical equipment and methods, glycosylase, enzyme, etc., can solve the problems of low substrate specificity, long conversion time and high cost of enzyme action, and achieve product separation. And the effect of easy purification, short conversion time and few reaction by-products

Inactive Publication Date: 2018-04-24
NANJING NORMAL UNIVERSITY
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are many related patent applications, the problems of long conversion time, low substrate specificity, low yield and high cost have not been well solved.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of method for biotransformation of Polygonin using thermostable β-glucosidase and its mutants
  • A kind of method for biotransformation of Polygonin using thermostable β-glucosidase and its mutants
  • A kind of method for biotransformation of Polygonin using thermostable β-glucosidase and its mutants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] The mutant primers were designed according to the β-glucosidase gene sequence of Thermotoga (Thermotiga) family 1, specifically:

[0019] N223T-N: AGTTTTCAATACCGGATATTTCGAACCTGCGAGT (SEQ ID NO. 4) and N223T-C: ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO. 5); The recombinant plasmid pET-20b-bglA (J) containing the wild-type β-glucosidase gene of Thermotoga was selected. Ind Microbiol Biotechnol, 2009, 36:1401–1408) was used as a template to perform inverse PCR amplification to obtain a nucleotide fragment containing the β-glucosidase mutant gene. Through phosphorylation, ligation, transformation, and extraction of the plasmid, the The recombinant plasmid of the N223T nucleotide fragment is further transformed into the host to express it to obtain the β-glucosidase mutant N223T of the present invention.

Embodiment 2

[0021] It is basically the same as Example 1, except that the primers used are: the upstream primer is G224F-N: 5'-AGTTTTCAACAACTTCTATTTCGAACCTGCGAGT-3' (SEQ ID NO. 6) and the downstream primer is G224F-C: 5'-ATTCCGATCTTTCCATCTTTCACG- 3'(SEQ ID NO. 7); to obtain a recombinant plasmid containing the G224F nucleotide fragment, and further transform the host to express it, to obtain the β-glucosidase mutant G224F of the present invention.

Embodiment 3

[0023] It is basically the same as Example 1, except that the primers used are: N223T / G224F-N: AGTTTTCAATACCTTCTATTTCGAACCTGCGAGT (SEQ ID NO. 8), and the downstream primer is N223T / G224F-C: ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO. 9). The recombinant plasmid containing the N223T / G224F nucleotide fragment is obtained, and the host is further transformed to express it, and the β-glucosidase mutant N223T / G224F of the present invention is obtained.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of heat-resisting beta-glucosidase mutants N223T, G224F and N223T / G224F in a conversion of polydatin to resveratrol. According to the heat-resisting beta- glucosidase mutants N223T, G224F and N223T / G224F, the amino acid sequences thereof are represented as SEQ: ID NO. 1, ID NO. 2 and ID NO. 3. By the use of the heat-resisting beta- glucosidase and the mutants thereof to hydrolyze the polydatin for preparing the resveratrol, comparing to the use of wild-type enzymes, the conversion efficiency is high, the reaction byproducts are fewer, the yield and purity are high, the separation and purification are easy, and chemical pollution is less.

Description

Technical field [0001] The present invention relates to the field of biotechnology, in particular to a heat-resistant β-glucosidase mutant N223T, G224F and N223T / G224F, and the application of the enzyme and its mutants in the conversion of polydatin to resveratrol. technical background [0002] Resveratrol is a kind of active polyphenols. It has anti-oxidation and anti-free radical effects. It can inhibit various oxidative reactions that cause atherosclerosis and thrombosis. Resveratrol has been listed as anti-cardiovascular One of the most promising anti-cancer drugs. Resveratrol is mostly found in Veratrum cuspidatum, Polygonum cuspidatum and grape skins, and its content is usually low. For example, the content of resveratrol in dried Polygonum cuspidatum rhizome is only 0.1%-0.2%, and the content of polydatin is significantly higher than that of resveratrol Retrol, about 2%. Studies have found that polydatin and arctiin in the form of glycosides do not have the best physiolo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/42C12P7/22
CPCC12N9/2445C12P7/22C12Y302/01021
Inventor 薛业敏候静静
Owner NANJING NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More