A kind of method for biotransformation of Polygonin using thermostable β-glucosidase and its mutants
A technology of glucosidase and mutant, which is applied in the fields of biochemical equipment and methods, glycosylase, enzyme, etc., can solve the problems of low substrate specificity, long conversion time and high cost of enzyme action, and achieve product separation. And the effect of easy purification, short conversion time and few reaction by-products
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] The mutant primers were designed according to the β-glucosidase gene sequence of Thermotoga (Thermotiga) family 1, specifically:
[0019] N223T-N: AGTTTTCAATACCGGATATTTCGAACCTGCGAGT (SEQ ID NO. 4) and N223T-C: ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO. 5); The recombinant plasmid pET-20b-bglA (J) containing the wild-type β-glucosidase gene of Thermotoga was selected. Ind Microbiol Biotechnol, 2009, 36:1401–1408) was used as a template to perform inverse PCR amplification to obtain a nucleotide fragment containing the β-glucosidase mutant gene. Through phosphorylation, ligation, transformation, and extraction of the plasmid, the The recombinant plasmid of the N223T nucleotide fragment is further transformed into the host to express it to obtain the β-glucosidase mutant N223T of the present invention.
Embodiment 2
[0021] It is basically the same as Example 1, except that the primers used are: the upstream primer is G224F-N: 5'-AGTTTTCAACAACTTCTATTTCGAACCTGCGAGT-3' (SEQ ID NO. 6) and the downstream primer is G224F-C: 5'-ATTCCGATCTTTCCATCTTTCACG- 3'(SEQ ID NO. 7); to obtain a recombinant plasmid containing the G224F nucleotide fragment, and further transform the host to express it, to obtain the β-glucosidase mutant G224F of the present invention.
Embodiment 3
[0023] It is basically the same as Example 1, except that the primers used are: N223T / G224F-N: AGTTTTCAATACCTTCTATTTCGAACCTGCGAGT (SEQ ID NO. 8), and the downstream primer is N223T / G224F-C: ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO. 9). The recombinant plasmid containing the N223T / G224F nucleotide fragment is obtained, and the host is further transformed to express it, and the β-glucosidase mutant N223T / G224F of the present invention is obtained.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



