Application of lrk2 gene or its encoded protein in promoting rice tillering
A technology that encodes proteins and genes, and is used in applications, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Embodiment 1 construction vector
[0029] 1. Primers used to construct the vector:
[0030] LRK2-1300-KpnI-F: GTCGGTACCATGCAGCCACCTCATTCTTCATGCAAC;
[0031] LRK2-1300-SalI-R: CAGGTCGACTCAGTCGGAGCCTACACTGTCCAG;
[0032] 2. Recombinant vector
[0033] ① Acquisition of LRK2 gene:
[0034] Extraction of rice total DNA:
[0035] 1) Put fresh rice leaves into a 1.5ml centrifuge tube and add 200μl of lysate.
[0036] 2) Use a grinding rod to grind the leaves into a homogenous slurry as much as possible to facilitate cracking.
[0037] 3) Place the centrifuge tube in a 65°C oven and incubate for 30 minutes, and mix thoroughly every 10 minutes.
[0038] 4) Take the centrifuge tube out of the oven, add 65 μl of 5M KAC solution, mix gently by inverting up and down, and then place it in an ice bath at -20°C for 5 minutes.
[0039] 5) Add 300 μl of chloroform, vigorously shake and mix, and centrifuge at 12000 rpm for 10 min.
[0040] 6) Take about 300μl of the supernatant, a...
Embodiment 2
[0088] Obtaining and identification of embodiment 2 transgenic rice
[0089] 1) Acquisition of transgenic rice
[0090] Rice receptor: Nipponbare.
[0091] Required culture medium (liquid):
[0092] Mature embryo callus induction medium: NB+2mg / L 2,4-D, pH=5.8, plant gel 3g / L;
[0093] Agrobacterium activation medium: YEP, pH=7.0;
[0094] Agrobacterium expansion medium: YEB+200μM AS, pH=7.0;
[0095] Agrobacterium suspension infection liquid: NB+2mg / L 2,4-D+200μM AS, pH=5.4;
[0096] Co-cultivation medium of callus and Agrobacterium: NB+2mg / L 2,4-D+200μM AS, pH=5.4, Phytogel 3g / L;
[0097] Transgenic callus selection medium: NB+2mg / L 2,4-D+500mg / L Cef+150mg / L G418 or 50mg / LHyg, pH=5.8, Phytogel 3g / L;
[0098] Transgenic callus differentiation medium: MS+0.5mg / L NAA+2mg / L 6-BA+0.5mg / L KT+75mg / L G418 or 25mg / L Hyg+125mg / L Cef, pH=5.8, Phytogel 3g / L;
[0099] Rooting medium for tissue culture regenerated shoots: 1 / 2MS+35mg / L G418 or 15mg / L Hyg+50mg / L Cef, pH=5.8, plant g...
Embodiment 3
[0119] Example 3 LRK2 promoter expression analysis
[0120] Prepare GUS dye solution, the formula is shown in Table 3. Submerge specific transgenic rice tissues (such as leaves, spikelets, stems, stem nodes, roots, and rhizome-combined bases) in GUS staining solution, vacuumize for 30-60min, and overnight at 37°C; remove plant materials with absolute ethanol Background color, photographed and recorded, stored at 4°C.
[0121] Table 3 1×GUS stain formula
[0122]
[0123] Such as Figure 5 As shown, the GUS staining results of LRK2 promoter indicated that LRK2 gene was expressed in tiller buds, nodes, roots and pollen.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More