Application of rice OsUBC27 gene or protein coded by rice OsUBC27 gene in increasing rice yield
A rice and gene technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of unreported application, lack of understanding of UBCs function, limited understanding of biological function, etc., and increase the grain length of rice , the effect of increasing the thousand-grain weight
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Cloning and transformation of the rice OsUBC27 gene.
[0030] RNA was extracted from young leaves of rice, and reverse-transcribed into cDNA using MLV reverse transcription reagent (Takara).
[0031] Total RNA was extracted using NucleoZOL kit (MACHEREY-NAGEL, Germany), the specific steps are as follows:
[0032] (1) Put 100 mg of leaves into a 2 mL sterilized centrifuge tube, add a small steel ball to each tube, quickly put the sample into liquid nitrogen, and use a proofing machine to break the leaf tissue;
[0033] (2) Add 1 mL of NucleoZOL extract, and after mixing, add 400 μL RNase-free water to each 1 mL of NucleoZOL extract to lyse the leaves, shake vigorously for 15s, and incubate at room temperature for 5-15 minutes;
[0034] (3) Centrifuge the sample for 15 minutes at 12000 rpm at room temperature;
[0035] (4) Transfer 1 mL of supernatant to a new 2 mL centrifuge tube;
[0036] (5) Add 1 mL of isopropanol to each 1 mL of supernatant to precipitate RNA, inc...
Embodiment 2
[0054] Identification of OsUBC27 gene expression in overexpression lines.
[0055] The seeds of hygromycin-positive transgenic T0 generation rice plants were collected, and the T2 generation lines were planted in the field from May to October 2021. When the rice tillering stage, young leaves were selected to extract total RNA, and reverse transcribed into cDNA for qRT-PCR ( The steps are the same as in Example 1). Using the rice constitutively expressed gene Actin as the internal reference, the primer sequences are as follows:
[0056] ActinF: GAAATGGAGACTGCCAAGACC;
[0057] ActinR: TTGGCAATCCACATCTGCTG;
[0058] UBC27-CDS-F and UBC27-CDS-R primers were used to detect the expression of OsUBC27 gene in different T2 rice lines. The results showed that the expression levels of OsUBC27 gene in the transgenic lines numbered OE78 and OE79 in the T2 generation transgenic lines were significantly higher than those in the wild-type lines, and the lines OE78 and OE79 were OsUBC27 gen...
Embodiment 3
[0060] Expression characteristics of OsUBC27 in different organs of rice.
[0061] Extract the RNA of rice roots (35 days), stems (35 days), leaves (35 days), ears (5-8em), seeds (12 days), reverse transcribed into cDNA for qRT-PCR analysis, the steps are the same as the embodiment 1. Using the constitutively expressed gene Actin in rice as an internal reference, cDNA templates from different rice tissues were amplified with primers UBC27-CDS-F and UBC27-CDS-R, and the expression of OsUBC27 gene in different tissues was detected. The results showed that the expression level of OsUBC27 gene was comparable in roots and ears, and higher than that in stems, leaves and seeds (e.g. image 3 shown).
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com