Primers, kit and pcr method for detecting the v600e mutation site of braf gene
A mutation site and kit technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of inability to detect clinical specimens on a large scale at the same time, complex interpretation of kit results, and high price of detection instruments problems, to avoid site mismatches, fast detection, and high detection sensitivity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0119] Example 1: Preparation of wild type and mutant positive plasmids for BRAF gene V600E mutation site
[0120] First, we retrieved the gene sequence before and after the BRAF gene V600E mutation site from the gene bank, marked the mutation site with a double underline, and designed a pair of clones at appropriate positions upstream and downstream of the mutation site (marked with bold and underline) Primers, the amplified fragment is 205bp, including the V600E mutation site, and the gene sequence is shown as follows:
[0121] SEQ No.1:
[0122] gagaatatctgggcctacattgctaaaatctaatgggaaagttttaggttctcctataaacttaggaaagcatctcacctcatcctaacacatttcaagccccaaaaatcttaaaagcaggttatataggctaaatagaactaatcattgttttagacatacttattgactctaagaggaaagatgaagtactatgttttaaagaatattatattacagaattatagaaattagatctcttacctaaactcttcataatgcttgctctgataggaaaatgagatctactgtttt cctttacttactac acctcag atatatttcttcatgaagacctcacagtaaaaataggtgattttggtctagctacag t gaaatctcgatggagtgggtcccatcagtttgaacagttgtctggatccattt...
Embodiment 2
[0138] Example 2: Design and specificity screening of allele-specific primers (ASP)
[0139] For the BRAF-V600E mutation site as an example, design wild-type and a series of mutation-specific primers as follows:
[0140] BRAF-V600E-WT-F: aaaataggtgattttggtctagctactgt (SEQ No. 8)
[0141] BRAF-V600E-mut-F: aaataggtgattttggtctagctactga (SEQ No. 9)
[0142] BRAF-V600E-mut-F1: aataggtgattttggtctagctactga (SEQ No. 10)
[0143] BRAF-V600E-mut-F2: ataggtgattttggtctagctactga (SEQ No. 11)
[0144] BRAF-V600E-mut-F3: aataggtgattttggtctagctacaca (SEQ No. 12)
[0145] BRAF-V600E-mut-F4: ataggtgattttggtctagctacaca (SEQ No. 13)
[0146] BRAF-V600E-mut-F5: taggtgattttggtctagctacaca (SEQ No. 14)
[0147] Simultaneously design and synthesize Taqman-specific probe BRAF-V600E-Probe (SEQ No.15):
[0148] FAM-ctcgatggagtgggtcccatcagt-BHQ1, related primers and probes were synthesized in Sangon Bioengineering (Shanghai) Co., Ltd.
[0149] Then use the above 7 primers and BRAF-V600E-R (SEQ No....
Embodiment 3
[0152] Embodiment 3: ASP sensitivity screening
[0153] We then paired the No. 7 primer with the BRAF-V600E-R primer respectively, and used the mutant recombinant plasmid according to 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10, 0 for serial dilution, plus Taqman-specific probes, sensitivity verification was performed on a fluorescent quantitative PCR instrument. Mutant-specific primer No. 7 can detect 100 copies of the mutant, so this primer is the best primer for detecting the BRAF-V600E mutation site screened according to our method, as shown in Table 3.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


