Escherichia coli gene engineering strain and construction method thereof, and application of strain in pyruvic acid production

A technology of genetically engineered bacteria and Escherichia coli, applied to other methods of inserting foreign genetic materials, bacteria, stably introducing foreign DNA into chromosomes, etc. Process control difficulty and fermentation cost

Active Publication Date: 2015-09-30
INST OF PROCESS ENG CHINESE ACAD OF SCI
View PDF3 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, vitamin auxotrophic toructus glabrata generally has the problem of low sugar-acid conversion rate
However, Escherichia coli engineering bacteria can not directly use the simple medium because they have knocked out the coding gene of the pyruvate dehydrogenase subunit or the acetic acid pathway, and need to add vitamins or acetic acid, etc., which increases the difficulty of controlling the fermentation process and the cost of fermentation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Escherichia coli gene engineering strain and construction method thereof, and application of strain in pyruvic acid production
  • Escherichia coli gene engineering strain and construction method thereof, and application of strain in pyruvic acid production
  • Escherichia coli gene engineering strain and construction method thereof, and application of strain in pyruvic acid production

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1, as figure 1 As shown, the construction of Escherichia coli genetically engineered bacteria

[0039] The construction of Escherichia coli genetically engineered bacteria I requires two steps.

[0040] (1) Knockout of the acyl-CoA thioesterase III gene (fadM) of Escherichia coli K-12MG1655

[0041] Such as figure 2 As shown, the gene knockout adopts the method of two-step homologous recombination.

[0042] In the first step, the pKD46 plasmid was transferred into the starting strain Escherichia coli K-12MG1655 by heat shock transformation method to obtain recombinant Escherichia coli A. The specific operation is as follows: absorb 1 μL of pKD46 plasmid and add it to the competent cells to mix evenly. After resting for 5 minutes, place in a water bath at 42°C for heat shock for 90 seconds, and then bathe in ice water for 3 minutes. Then add 800 μL of LB medium without antibiotics, incubate at 30°C, 140rpm for 1h, spread on the Amp resistant plate, and ...

Embodiment 2

[0063] Embodiment 2, as figure 1 As shown, the construction of Escherichia coli genetically engineered bacteria II

[0064] The acetyl phosphorylase gene (pta) and the acetate kinase gene (ackA) of Escherichia coli genetically engineered strain I were knocked out to construct Escherichia coli genetically engineered strain II.

[0065] Such as figure 2 As shown, the gene knockout adopts the method of two-step homologous recombination.

[0066] In the first step, the NDA sequences of ackA and pta genes were found in the NCBI database, and primers ackA-pta-F / ackA-pta-R were designed based on this, where ackA-pta-F included 50bp upstream of ackA and cat-sacB ackA-pta-R includes 50 bp upstream of ackA, 50 bp downstream of pta, and 25 bp downstream of cat-sacB. The plasmid p EASY-cat-sacB was used as a template for PCR amplification. The primer sequences are:

[0067] ackA-pta-F (SEQ ID NO: 9):

[0068] CTATGGCTCCCTGACGTTTTTTTAGCCACGTATCAATTATAGGTACTTCCGTGACGGAAGATCACTTCGCAGA ...

Embodiment 3

[0074] Embodiment 3, as figure 1 As shown, the construction of Escherichia coli genetically engineered bacteria III

[0075] The pyruvate oxidase (poxB) of Escherichia coli genetically engineered strain II was knocked out to construct Escherichia coli genetically engineered strain III.

[0076] Such as figure 2 As shown, the gene knockout adopts the method of two-step homologous recombination.

[0077] In the first step, the NDA sequence of the poxB gene was found in the NCBI database, and based on this, the primers poxB-F / poxB-R were designed, wherein poxB-F included 50 bp upstream of poxB, 50 bp downstream of poxB and 25 bp upstream of cat-sacB, poxB-R includes 50 bp downstream of poxB and 25 bp downstream of cat-sacB. PCR amplification was performed using the plasmid p EASY-cat-sacB as a template. The primer sequences are:

[0078] poxB-F (SEQ ID NO: 11):

[0079] TATGCCCGATGATATTCCTTTCATCGGGCTATTTAACCGTTAGTGCCTCCAAAGGGTGGCATTTCCCGTCATAATAAGGACATGCCATGATTGATTTACGGTGAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Escherichia coli gene engineering strain, and a construction method an application thereof. The construction method comprises the following steps: lowering or inhibiting thioesterase activity in initial Escherichia coli, and inactivating the acetic acid synthesis pathway to obtain the Escherichia coli gene engineering strain YP01. The Escherichia coli gene engineering strain YP01 can convert 95 g / L glucose into 69 g / L pyruvic acid when being fermented in an inorganic salt culture medium under aerobic conditions for 48 hours, and is suitable for industrial production.

Description

technical field [0001] The invention belongs to the technical field of microbial genetic engineering. Specifically, the invention relates to an E. coli genetically engineered bacterium, a construction method thereof, and an application in producing pyruvate. Background technique [0002] Pyruvic acid (Pyruvic acid), light yellow to yellow transparent liquid, is one of the basic metabolic intermediates of organisms, widely used in food additives, pesticides, medicine and other fields. It can be used as a precursor to enzymatically synthesize L-tryptophan, L-tyrosine, D- / L-alanine and L-dihydroxyphenylalanine, etc. The field of health has application potential. At present, the synthesis of pyruvic acid mainly adopts chemical method, which is obtained by the reaction of tartaric acid and potassium pyrosulfate. Due to the low conversion rate of raw materials and harsh reaction conditions, the total cost is relatively high. In contrast, the production of pyruvic acid by fermen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/90C12P7/40
Inventor杨茂华邢建民刘谊兰白冰
OwnerINST OF PROCESS ENG CHINESE ACAD OF SCI