Optimized targeted MD-2 efficient anti-inflammatory polypeptide

A MD-2, targeted technology, applied in the field of biomedicine, to achieve high affinity, strong anti-inflammatory effect, and reduce the effect of LPS stimulating macrophages to synthesize and release inflammatory mediators

Inactive Publication Date: 2015-11-18
THE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] At present, there is no new type of biological agent developed directly for the occurrence and development of sepsis in the medical market at home and

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Optimized targeted MD-2 efficient anti-inflammatory polypeptide
  • Optimized targeted MD-2 efficient anti-inflammatory polypeptide
  • Optimized targeted MD-2 efficient anti-inflammatory polypeptide

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0036] Example 1. Construction of phage mutant peptide library

[0037] 1.1 Basic primers and mutant primers

[0038] Basic primer:

[0039] 96Etp: CATGCCCGGGTACCTTTCTATTCTCACTCT (for construction and colony PCR identification)

[0040] T6:TTTCGGCCGAACCTCCACCATGATTATCCGGCACCGTCTTAGAGTGAGAATAGAAAGGT

[0041] T11:TTTCGGCCGAACCTCCACCATTCCTAGTCAACGGAGAATCAGAGTGAGAATAGAAAGGT

[0042] 96gIIIsp: CCCTCATAGTTAGCGTAACG (for sequencing and colony PCR identification)

[0043] Synthetic strategy of mutant primers:

[0044] The T6 and T11 binding peptides are screened against the huMD2 mimic short peptide (FSKGKYKCV). The sequence is located at one end of the β-sheet chain of the huMD2 protein and the adjacent random coiled region, and it is basically linearly distributed. In order to obtain peptides with higher binding capacity, based on the T6 and T11 sequences, randomly mutate the adjacent 3-5 amino acids each time, retaining the original 2-4 amino acids, and at the same time at the amino and carbox...

Example Embodiment

[0081] Example 2. Screening of phage peptide library

[0082] 2.1 Enrichment of specific phage clones that have binding activity to MD2 protein

[0083] Immune tube coating: Dilute antigen huMD210μg to 1ml with sterile TBS buffer, and coat the immune tube (Nunc, MaxiSorp) overnight at 4°C. Immune tube blocking: Use 5ml of 1% BSA blocking solution to seal the immune tube and incubate at 37°C for 2h. Washing: Discard the blocking solution, and wash the immunotube 3 times with TBST (T: 0.1% Tween-20). Phage binding: Add 3ml of phage sample (containing 0.5% BSA and 0.1% Tween-20), incubate at 37°C for 2 hours, and mix once every 30 minutes. Washing: Wash the immune tube 6 times with TBST (T: 0.1% Tween-20) to wash away unbound phage. Elution: Elute the bound phage with Glycine-HCl (pH 2.1), 1 mL / time, 5 min each time, and then add 160 μl of Tris neutralization solution. Repeat the elution once and then combine. Infection: From the eluted phage sample, take 10μl for gradient diluti...

Example Embodiment

[0104] Example 3. Cytokine production inhibition test

[0105] 3.1 Cell culture

[0106] RAW264.7 was purchased from ATCC, and human pre-monocytes (THP-1) were donated by the Fourth Research Laboratory, Institute of Field Surgery, Third Military Medical University. RAW264.7 cells and THP-1 cells are cultured in RPMI1640 complete medium containing 10% fetal bovine serum. THP-1 cells need to be stimulated by phorbol ethyl ester (Phorbolmyristate acetate, PMA) to differentiate into mononuclear macrophages . After THP-1 is cultured and counted, add PMA100ng / ml and co-culture for 24h, adjust the cell count to 1×10 5 Pcs / hole. RAW264.7 directly adjusts the cell count to 1×10 5 Pcs / hole.

[0107] 3.2 Determination of the inhibitory effect of 5 clones on the cytokine production of RAW264.7 and THP-1

[0108] After RAW264.7 and PMA-induced THP-1 were washed with PBS for 3 times, the cell concentration was adjusted to 1×10 with 1640 culture medium containing 10% fetal bovine serum 5 Pcs / hole...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

T6 and T11 are based, a mutational peptide library is constructed by adopting an NNK strategy, MD-2 (myeloid differential protein 2) full-length protein is used as target protein, and the mutational peptide library is subjected to affinity selection, so as to realize high-affinity phage clone. Through cell factor generation inhibiting experiment and detection of expression of inflammatory medium in animal serum, the fact that fusion peptide shown in one phage clone can simulate anti-inflammatory polypeptide of MD-2 is discovered, and the amino acid sequence of the anti-inflammatory polypeptide is KRKMRMNTRRL. The combination of the anti-inflammatory polypeptide and MD-2 full-length protein is higher than original T6 and T11 clone, the possibility that lipopolysaccharide (LPS) stimulates macrophage to synthesize and release inflammatory medium can be obviously reduced, and the anti-inflammatory effect is obviously higher than that of original polypeptide.

Description

technical field [0001] The invention belongs to the field of biomedicine, and particularly relates to an optimized high-efficiency anti-inflammatory polypeptide targeting MD-2, and the preparation of the polypeptide for treating diseases related to excessive inflammatory damage caused by infection, such as sepsis in the application. Background technique [0002] Sepsis caused by bacterial infection, especially Gram-negative bacterial infection, has become the main cause of death in clinical patients, especially surgical ICU patients. Infection caused by bacteria to the body Sepsis is usually produced by stimulation of the body by bacterial exotoxins and endotoxins. After bacterial toxins enter the body, they first stimulate immune inflammatory cells, and initiate the body’s immune response to infection through the body’s pattern recognition receptors, mainly TLR2 and TLR4 receptors. The body causes a cascade of excessive inflammatory damage. In view of this, using appropr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K7/06C07K19/00C12N15/11C12N15/62A61K38/08A61K48/00A61P29/00A61P31/04
Inventor 闫红李磊谭燕吴晓凤
Owner THE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap