Optimized targeted MD-2 efficient anti-inflammatory polypeptide

A MD-2, targeted technology, applied in the field of biomedicine, to achieve high affinity, strong anti-inflammatory effect, and reduce the effect of LPS stimulating macrophages to synthesize and release inflammatory mediators

Inactive Publication Date: 2015-11-18
THE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] At present, there is no new type of biological agent developed directly for the occurrence and development of sepsis in the medical market at home and abroad. Once the basic and clinical experiments are completed and approved for clinical application, it will have very obvious social and economic benefits.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Optimized targeted MD-2 efficient anti-inflammatory polypeptide
  • Optimized targeted MD-2 efficient anti-inflammatory polypeptide
  • Optimized targeted MD-2 efficient anti-inflammatory polypeptide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1, the construction of phage mutant peptide library

[0037] 1.1 Basic primers and mutation primers

[0038] Basic primers:

[0039] 96Etp:CATGCCCGGGTACCTTTTCTATTCTCACTCT (for construction and colony PCR identification)

[0040] T6:TTTCGGCCGAACCTCCACCATGATTATCCGGCACCGTCTTAGAGTGAGAATAGAAAGGT

[0041] T11: TTTCGGCCGAACCTCCACCATTCCTAGTCAACGGAGAATCAGAGTGAGAATAGAAAGGT

[0042] 96gIIIsp: CCCTCATAGTTAGCGTAACG (for sequencing and colony PCR identification)

[0043] Synthesis strategy for mutant primers:

[0044] The T6 and T11 binding peptides are screened against the huMD2 analog short peptide (FSKGKYKCV). The sequence is located at one end of the β-fold chain of the huMD2 protein and the adjacent random coil region, and is basically linearly distributed. In order to obtain a polypeptide with higher binding capacity, based on the T6 and T11 sequences, the adjacent 3-5 amino acids are randomly mutated each time, the original 2-4 amino acids are retained, and at ...

Embodiment 2

[0081] Example 2, Screening of phage peptide library

[0082] 2.1 Enrichment of specific phage clones with binding activity to MD2 protein

[0083] Coating of immunotubes: 10 μg of antigen huMD2 was diluted to 1 ml with sterile TBS buffer, and immunotubes (Nunc, MaxiSorp) were coated overnight at 4°C. Immunotube sealing: Seal the immunotube with 5ml of 1% BSA blocking solution, and incubate at 37°C for 2h. Washing: discard the blocking solution, and wash the immunotube 3 times with TBST (T: 0.1% Tween-20). Phage binding: add 3ml of phage sample (containing 0.5% BSA and 0.1% Tween-20), incubate at 37°C for 2h, and mix well every 30 minutes. Washing: Wash the immunotube 6 times with TBST (T: 0.1% Tween-20) to wash away unbound phage. Elution: Elute the bound phage with Glycine-HCl (pH 2.1), 1 mL / time, 5 min each time, and then add 160 μl of Tris neutralizing solution. Repeat elution once, then pool. Infection: Take 10 μl from the eluted phage sample for serial dilution and ...

Embodiment 3

[0104] Embodiment 3, cytokine production inhibition test

[0105] 3.1 Cell Culture

[0106] RAW264.7 was purchased from ATCC, and human promonocytes (THP-1) were donated by the Fourth Laboratory of Field Surgery Institute, Third Military Medical University. RAW264.7 cells and THP-1 cells were cultured in RPMI1640 complete medium containing 10% fetal bovine serum, and THP-1 cells could differentiate into monocyte-macrophage-like cells only after being stimulated by phorbol ethyl ester (PMA) . After THP-1 was cultured and counted, PMA100ng / ml was added for co-cultivation for 24h, and the cell count was adjusted to 1×10 5 pcs / hole. RAW264.7 directly adjusts the cell count to 1×10 5 pcs / hole.

[0107] 3.2 Determination of the inhibitory effect of the 5 clones from the preliminary screening on the cytokine production of RAW264.7 and THP-1

[0108] RAW264.7 and THP-1 induced by PMA were washed 3 times with PBS, and the cell concentration was adjusted to 1×10 with 1640 culture ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

T6 and T11 are based, a mutational peptide library is constructed by adopting an NNK strategy, MD-2 (myeloid differential protein 2) full-length protein is used as target protein, and the mutational peptide library is subjected to affinity selection, so as to realize high-affinity phage clone. Through cell factor generation inhibiting experiment and detection of expression of inflammatory medium in animal serum, the fact that fusion peptide shown in one phage clone can simulate anti-inflammatory polypeptide of MD-2 is discovered, and the amino acid sequence of the anti-inflammatory polypeptide is KRKMRMNTRRL. The combination of the anti-inflammatory polypeptide and MD-2 full-length protein is higher than original T6 and T11 clone, the possibility that lipopolysaccharide (LPS) stimulates macrophage to synthesize and release inflammatory medium can be obviously reduced, and the anti-inflammatory effect is obviously higher than that of original polypeptide.

Description

technical field [0001] The invention belongs to the field of biomedicine, and particularly relates to an optimized high-efficiency anti-inflammatory polypeptide targeting MD-2, and the preparation of the polypeptide for treating diseases related to excessive inflammatory damage caused by infection, such as sepsis in the application. Background technique [0002] Sepsis caused by bacterial infection, especially Gram-negative bacterial infection, has become the main cause of death in clinical patients, especially surgical ICU patients. Infection caused by bacteria to the body Sepsis is usually produced by stimulation of the body by bacterial exotoxins and endotoxins. After bacterial toxins enter the body, they first stimulate immune inflammatory cells, and initiate the body’s immune response to infection through the body’s pattern recognition receptors, mainly TLR2 and TLR4 receptors. The body causes a cascade of excessive inflammatory damage. In view of this, using appropr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K7/06C07K19/00C12N15/11C12N15/62A61K38/08A61K48/00A61P29/00A61P31/04
Inventor闫红李磊谭燕吴晓凤
OwnerTHE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA