KSHV virus vIRF4 DNA binding domain and polyclonal antibody thereof, and preparation method of polyclonal antibody

A technology that combines domains and viruses, applied in the fields of virology and bioengineering, can solve problems such as no resistance to Kaposi's sarcoma

Inactive Publication Date: 2015-11-25
INST PASTEUR OF SHANGHAI CHINESE ACADEMY OF SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It has been more than 120 years since Moritz Kaposi, a Viennese dermatologist in Austria-Hungary, first described Kaposi's sarcoma in 1872, and 1994, when scientists first detected the existence of KSHV in AIDS patients with Kaposi's sarcoma. Finding an effective way to fight the virus to treat Kaposi's sarcoma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • KSHV virus vIRF4 DNA binding domain and polyclonal antibody thereof, and preparation method of polyclonal antibody
  • KSHV virus vIRF4 DNA binding domain and polyclonal antibody thereof, and preparation method of polyclonal antibody
  • KSHV virus vIRF4 DNA binding domain and polyclonal antibody thereof, and preparation method of polyclonal antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Embodiment 1, transformation of expression plasmid

[0047] pET28atp is a modified plasmid based on pET28a. The pET28 before transformation has the following sites:

[0048] NcoI-6*His-Thrombin-Nde / NheI-T7tag-BamHI / EcoRI / SacI / SalI / HindIII / NotI / XhoI-Histag;

[0049] The modified pET28a has the following sites:

[0050] NcoI-6*His-TEV-Nde / NheI-T7tag-BamHI / EcoRI / SacI / SalI / HindIII / NotI / XhoI-Histag.

[0051] It can be seen that the protease cleavage site after the 6*His tag of the plasmid before transformation is Thrombin, and the protease cleavage site after the transformation 6*His tag is TEV. There are two main reasons for the transformation based on this point: on the one hand, TEV Enzyme digestion efficiency is higher, on the other hand, the use of strains expressing TEV protease can express and purify TEV protease efficiently and rapidly.

Embodiment 2

[0052] Example 2. Obtaining of KSHVvIRF4 DNA Binding Domain Gene Fragment Sequence

[0053] Using the kshvcDNA genome as a template, design primers in Table 1 (primers were synthesized by Shanghai Sangong Company).

[0054] Table 1

[0055]

Primer sequence F cgtcgaGGATCC tcagaatgggccacgttatgg R cgtcgaCTCGAGttATTtaaacggcgttcgcaccaac

[0056] Among them, the forward primer introduces the BamHI restriction site GGATCC, the reverse primer introduces the XhoI restriction site: CTCGAG, and the base before the restriction site is the protection base. An ATT stop codon was added after the cleavage site of the reverse primer. The kit used for gene amplification comes from 2*fastpfumix of Quanshijin Company, and the PCR reaction system is shown in Table 2.

[0057] Table 2

[0058] upstream primer 2ul(20um) downstream primer 2ul(20um) genomic cDNA 20ul 2*fast pfu miX 25ul f 2 o 1ul total capacity 50ul

[...

Embodiment 3

[0062] Embodiment 3, construction contains the expression vector of target gene fragment

[0063] For the amplification of the vector pET-28a containing multiple cloning sites, the plasmid was recovered with Tiangen’s plasmid recovery kit, and the target gene fragment recovered from the gel after double-enzyme digestion and PCR amplification and the plasmid of the empty vector were respectively used. Use NEB company's BamHI restriction endonuclease and XhoI restriction endonuclease to double-digest, and the double-digestion system is shown in Table 3.

[0064] table 3

[0065] Bam H 1ul 1ul wxya 1ul 1ul CutSmart Buffer 5ul 5ul gene fragment or plasmid 30ul 30ul Add ddH 2 Total volume after O 50ul 50ul

[0066] Enzyme digestion in water bath at 37°C for 3 hours, and the target gene fragment and vector fragment were recovered by gel respectively for ligation reaction. The enzyme used to ligate the target fragment and the vector frag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a KSHV virus vIRF4 DNA binding domain and a polyclonal antibody thereof, and a preparation method of the polyclonal antibody. According to the present invention, the KSHV virus vIRF4 DNA binding domain is subjected to recombinant expression by using a genetic engineering technology, and the murine polyclonal antibody is prepared by immunizing animals, wherein the antibody has excellent binding specificity.

Description

technical field [0001] The invention belongs to the fields of virology and bioengineering; more specifically, the invention relates to the KSHV virus vIRF4 DNA binding domain, its polyclonal antibody and a preparation method. Background technique [0002] Kaposi's sarcoma associated herpesvirus (Kaposi'ssarcoma associated herpesvirus, KSHV), also known as human herpesvirus type 8, is the pathogen that causes Kaposi's sarcoma, KSHV and primary effusion lymphoma (PEL), multicentric card Sterman's disease (MCD) also had a clear association. The malignant tumor with the highest incidence rate in AIDS patients is KS, and there is also a higher incidence rate of KS in organ transplantation groups. It has been more than 120 years since Moritz Kaposi, a Viennese dermatologist in Austria-Hungary, first described Kaposi's sarcoma in 1872, and 1994, when scientists first detected the existence of KSHV in AIDS patients with Kaposi's sarcoma. Finding an effective means of treating Kapo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/03C12N15/38C07K16/08G01N33/68G01N33/571
Inventor蓝柯胡海岱梁德光
OwnerINST PASTEUR OF SHANGHAI CHINESE ACADEMY OF SCI