Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for expressing Cecropin DC1 through insect cells

An insect cell and antimicrobial peptide technology, which is applied in the field of insect cell expression antimicrobial peptide CecropinDC1, can solve the problems of limited expression, easy loss of target genes, unstable plasmid transformants, etc., and achieve high bactericidal potency and high biological activity.

Active Publication Date: 2015-12-30
GUANGDONG COOWAY BIOTECH CO LTD
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the expression of the target gene DC in Candida monsoonii is limited, the plasmid transformant is unstable, and the target gene is easily lost, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing Cecropin DC1 through insect cells
  • Method for expressing Cecropin DC1 through insect cells
  • Method for expressing Cecropin DC1 through insect cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Cloning of Antimicrobial Peptide CecropinDC1 Gene

[0026] According to the needs of gene modification and cloning of the antimicrobial peptide CecropinDC1, primers were designed and synthesized using Primerpremier5.0 software:

[0027] P1: 5'ATGAAATGGAAGTTGTTCAAAAA3';

[0028] P2:5'GTTAGCCAAAGGCAGTAGC3'

[0029] The PCR amplification reaction is: pre-denaturation at 93°C for 5 minutes; denaturation at 93°C for 30 seconds; annealing at 58°C for 60 seconds; extension at 72°C for 1 minute; after 30 cycles, extension at 72°C for 10 minutes, and incubation at 4°C.

[0030] Use 1% agarose gel electrophoresis to carry out PCR product analysis to antimicrobial peptide CecropinDC1 gene (the result is as follows figure 1 Shown) Swimming lane 1 is compared with the DNA molecular weight marker (DL2000), and the target fragment of about 140 can be clearly seen, indicating that the antimicrobial peptide CecropinDC1 gene was successfully synthesized. Gel Extraction Kit (GelExtract...

Embodiment 2

[0032] get recombinant virus

[0033] The constructed recombinant transfer vector was co-transfected with Sf21 insect cells with the polynucleated polyhedrosis virus AcNPV-DNA of Spodoptera californica, and the recombinant virus expressing the antimicrobial peptide CecropinDC1 was obtained in the following manner.

[0034] Add 2 μg recombinant transfer vector DNA, 10 μg AcNPV-DNA and 0.8 ml co-transfection buffer to a 1.5 ml sterilized Eppendorf tube, incubate the mixture for 30 min at room temperature and co-transfect Sf21 insect cells in logarithmic growth phase; then After co-transfection, Sf21 cells were washed twice with serum-free medium Sf-900IISFM medium (without antibiotics or other additives), and then cultured with fresh medium containing 10% FCS at 27°C for 4~6d , the medium supernatant was collected as the virus stock solution to screen the recombinant virus, and the recombinant virus was screened by plaque to obtain a virus solution, which was named as the recomb...

Embodiment 3

[0036] Extraction of recombinant baculovirus

[0037] 1) Take a 1.5ml centrifuge tube and add 20μl ProteinaseK solution.

[0038] 2) Add 200 μl serum or plasma to the centrifuge tube, then add 200 μl BufferGB, and vortex for 15 sec.

[0039] 3) Incubate at 56°C for 15 minutes, centrifuge briefly, and collect the solution on the tube wall to the bottom of the tube.

[0040] 4) Add 250 μl absolute ethanol, vortex for 15 sec, place at room temperature for 5 min, centrifuge briefly, and collect the solution on the tube wall to the bottom of the tube.

[0041] 5) Put a SpinColumnsCG * Put it into CollectionTubes (2ml), transfer the solution obtained in the previous step to a centrifugal adsorption column, centrifuge at 10000rpm for 30sec, and discard the waste liquid in the collection tube.

[0042] 6) Add 500 μl of BufferGD to the adsorption column, centrifuge at 10,000 rpm for 30 sec at room temperature, and discard the waste liquid in the collection tube.

[0043] 7) Add 500...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
The average diameteraaaaaaaaaa
The average diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for expressing Cecropin DC1 through insect cells. According to a sequence of natural Cecropin, genetic engineering is utilized, a gene of the Cecropin DC1 is designed and synthesized, a recombinant virus containing the gene of the Cecropin DC1 is constructed, and the SF21 cells are utilized as hosts for expressing and producing the recombinant Cecropin DC1 with biological activity.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for insect cells to express the antimicrobial peptide CecropinDC1. Background technique [0002] Antimicrobial peptides are a class of biologically active small-molecule basic polypeptides, which have the advantages of strong bactericidal power, broad antibacterial spectrum, good stability, and no drug resistance. More importantly, antimicrobial peptides have almost no effect on eukaryotic cells , only acts on prokaryotic cells and eukaryotic cells with pathological changes. [0003] Existing technology review found that Chinese patent ZL200510032743.8 announced an antimicrobial peptide DC and its preparation method and application. According to the sequence of the natural antimicrobial peptide, the antimicrobial peptide DC gene was designed and synthesized, the genetic codes preferred by yeast were selected, and the shuttle plasmid was transformed. , and transferred to sea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/866C07K14/435C12N15/12
Inventor 黄自然陈松彬倪彦燕
Owner GUANGDONG COOWAY BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More