Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for high flux synthesis of nucleotide pool and assembling of double-stranded DNA from semiconductor chips

A nucleotide pool and semiconductor technology, applied in the field of molecular biology, can solve the problems of high cost, cumbersome steps, low degree of integration and miniaturization, etc., and achieve the effect of low cost

Inactive Publication Date: 2016-01-13
SUZHOU HONGXUN BIOTECH CO LTD
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The method commonly used in the current technology is to synthesize nucleotides on a chip and then assemble double-stranded DNA using this as a raw material. The steps of gene synthesis and error repair are cumbersome, the degree of integration and miniaturization is low, and the cost is high. Therefore, a method is now needed Combining semiconductor chip synthesis technology and DNA large fragment assembly technology together, using electrochemical semiconductor chip and DNA large fragment assembly technology to successfully develop a next-generation DNA synthesis platform

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for high flux synthesis of nucleotide pool and assembling of double-stranded DNA from semiconductor chips
  • Method for high flux synthesis of nucleotide pool and assembling of double-stranded DNA from semiconductor chips
  • Method for high flux synthesis of nucleotide pool and assembling of double-stranded DNA from semiconductor chips

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Such as figure 1 As shown, a method for high-throughput synthesis of a semiconductor chip nucleotide pool and assembled double-stranded DNA is disclosed in Embodiment 1, the method comprising the following steps:

[0034] (1) Divide the pre-synthesized double-stranded DNA into multiple 200-1000bp DNA fragments.

[0035] (2) Design nucleotides with the DNA fragment described in (1), the length of each nucleotide is 30-90nt, the last 4 bases and the next nucleotide at the 3' end of each nucleotide The first 4 nucleotide sequences of the 5' end are the same.

[0036] (3) Add a 20nt flank sequence to the 30-90nt nucleotide ends designed in (2), and the restriction endonuclease MlyI restriction endonuclease recognition sequence of Type II, and synthesize a total length of 80-200nt Nucleotide sequence, the nucleotide sequence is prepared with a semiconductor chip; In the present embodiment, the TypeII restriction endonuclease can be all TypeII restriction endonucleases that...

Embodiment 2

[0041] In Example 2, using the method disclosed in Example 1, a semiconductor chip was used to synthesize a nucleotide pool and use it as a raw material to assemble double-stranded DNA.

[0042] 步骤1:将预合成的双链DNA分成多个DNA片段,DNA片段的序列如下:GGATCCAGAGCAGAGGAGCCAGCTGTGGGCACCAGTGGCCTCATCTTCCGAGAAGACTTGGACTGGCCTCCAGGCAGCCCACAAGAGCCTCTGTGCCTGGTGGCACTGGGCGGGGACAGCAATGGCAGCAGCTCCCCCCTGCGGGTGGTGGGGGCTCTAAGCGCCTATGAGCAGGCCTTCCTGGGGGCCGTGCAGAGGGCCCGCTGGGGCCCCCGAGACCTGGCCACCTTCGGGGTCTGCAACACCGGTGACAGGCAGGCTGCCTTGCCCTCTCTACGGCGGCTGGGGGCCTGGCTGCGGGACCCTGGGGGGCAGCGCCTGGTGGTCCTACACCTGGAGGAAGTGACCTGGGAGCCAACACCCTCGCTGAGGTTCCAGGAGCCCCCGCCTGGAGGAGCTGGCCCCCCACTCGAG

[0043] Step 2: Design primers, the designed primers are as shown in Table 1:

[0044] Table 1 Primer list designed

[0045]

[0046] Step 3: Add a 20nt flank sequence and a restriction enzyme recognition site sequence to both ends of the primer designed in step 2. In this example, the restriction endonuclease MlyI is used as an example, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for high flux synthesis of a nucleotide pool and assembling of a double-stranded DNA from semiconductor chips. The method comprises the following steps: 1, dividing a pre-synthesized double-stranded DNA into a plurality of DNA fragments; 2, designing nucleotides by using the DNA fragments; 3, arranging a flank sequence and a recombinase digestion identification sequence to each of two ends of each of the nucleotides to synthesize nucleotide sequences, wherein the nucleotide sequences are prepared from the semiconductor chips; 4, washing out the nucleotides from the semiconductor chips; 5, carrying out PCR amplification with the flank sequence as a primer to obtain a PCR product for later use, wherein the amount of every synthesized nucleotide obtained after the PCR amplification is greatly increased; and 6, splicing the nucleotides by using he recombinase digestion PCR product, and cutting while splicing to obtain double-stranded DNA fragments. The method has the advantages of low cost and high one-time synthesis flux, and can be used in assembling of metabolism pathways, biological approaches, biological element databases or genomes.

Description

technical field [0001] The invention belongs to the field of molecular biology, in particular to the technical field of DNA synthesis, and specifically relates to a high-throughput method for synthesizing nucleotide pools and assembling double-stranded DNA on semiconductor chips. Background technique [0002] Synthetic biology is an emerging interdisciplinary subject in the 21st century. It uses engineering research ideas to design and modify genes, biological components, biological pathways, and even the entire genome. It is used in the fields of biology, medicine, environmental protection, energy, and agriculture. It has broad application prospects. Synthetic biology technology mainly includes: synthesis of double-stranded DNA, synthesis of regulatory elements, operon synthesis, gene synthesis, etc. Among them, gene synthesis is the main component of synthetic biology and the basis and skeleton of synthetic biology. Gene synthesis refers to the technology of artificially ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10
Inventor 齐金才刁文一柳伟强孙德斌杨平
Owner SUZHOU HONGXUN BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com