Kit for detecting lncARSR in serum and application of kit in detection of kidney cancer sunitinib drug resistance

A detection kit and detection reagent technology, applied in the field of medical biological detection, can solve the problem that the value of serological markers has not been reported in literature, achieve a good prospect of translational medicine, and avoid the effect of ineffective treatment

Inactive Publication Date: 2016-01-20
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The value of lncARSR as a serological marker has not been reported in the literature so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting lncARSR in serum and application of kit in detection of kidney cancer sunitinib drug resistance
  • Kit for detecting lncARSR in serum and application of kit in detection of kidney cancer sunitinib drug resistance
  • Kit for detecting lncARSR in serum and application of kit in detection of kidney cancer sunitinib drug resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Screening and identification of lncARSR

[0042] We previously constructed sunitinib-resistant kidney cancer cell lines 7SuR and ACSuR (preservation numbers: CCTCCC2014217, CCTCCC2014238), and have applied for the Chinese invention patent CN201510304372.8, the invention name is "kidney cancer sunitinib resistance Cell lines and methods for their construction".

[0043] In order to study lncRNAs related to sunitinib resistance, we used lncRNA microarray analysis on renal cancer parental cells and drug-resistant cells, and screened 8 most significantly elevated lncRNAs. Further, we used RNAi technology to verify the function of 8 lncRNAs, and found that interfering with lncARSR restored the sensitivity of drug-resistant cells to sunitinib ( figure 1 ). The above results suggest the role of lncARSR in RCC sunitinib resistance, and also suggest that it may have application value as a diagnostic marker for sunitinib resistance.

Embodiment 2

[0044] Example 2: Collection and processing of serum samples and extraction of small RNAs

[0045] (1) Serum sample collection: Collect about 6ml of peripheral blood from kidney cancer patients and put it into an anticoagulant tube containing EDTA, and let it stand for about 1 hour.

[0046] (2) Serum sample processing: the collected peripheral blood samples were centrifuged at 4000 rpm for 10 min at 4°C, the supernatant was taken and packed into EP tubes, and stored at -80°C.

[0047] (3) Extraction of RNA in serum: 350 μl of each serum sample was taken, 1 μl of exogenous standard RNA (λpolyA+RNA-A) (purchased from TAKARA Company) was added, and then mirVana purchased from Ambion Company was used to TM PARIS TM Kit to extract small RNA.

[0048](4) Reverse transcription into cDNA: take the same amount of RNA from each sample, and perform reverse transcription with random primer N6. According to 5×M-MLVRTBuffer 5 μl, M-MLVRversetranscriptase 1 μl, rRNasin 0.5 μl (Promega Co...

Embodiment 3

[0049] Example 3: Primer Design and Verification

[0050] (1) Primer design: use the Ensemble database to check the full-length sequence of lncARSR (ENST00000424980), and use PrimerPremier5 software to design a pair of upstream and downstream primers for Real-timePCR for the sequence of lncARSR, as follows:

[0051] Upstream primer: TTTGAAATGCTCTTTGAGGGAT (SEQ ID NO: 1);

[0052] Downstream primer: TGCAGGTTGTCTGAAGTTGGA (SEQ ID NO: 2);

[0053] The primers were synthesized by Shanghai Sangong Company.

[0054] (2) Primer verification: SYBRPremixExTaq from TaKaRa Company TM Reagents and the ViiA7Dx real-time quantitative PCR instrument of Applied Biosystems in the United States were used to carry out the PCR reaction according to the following system:

[0055]

[0056] PCR conditions:

[0057]

[0058] According to the above Real-timePCR conditions, the lncARSR primers were detected by using the reverse transcription products of 8 serum samples prepared earlier. Two ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of medical and biological detection, and provides application of lncARSR in preparation of a kidney cancer sunitinib drug resistance detecting marker, and application of lncARSR in preparation of a kidney cancer sunitinib drug resistance detecting reagent or kit. The invention further establishes a method for detecting lncARSR in human serum, and provides the kit for detecting lncARSR in serum. By detecting serum of kidney cancer patients receiving sunitinib treatment, it is found that the content of lncARSR in serum of the drug resistance patient is obviously higher than that of lncARSR in serum of the sensitive patient. The kit is beneficial for monitoring the clinical curative effect of sunitinib medicine, thereby avoiding further invalid treatment.

Description

technical field [0001] The invention relates to the technical field of medical biological detection, in particular to a kit for detecting lncARSR in serum and its application in detecting sunitinib resistance of kidney cancer. Background technique [0002] The incidence of renal cell carcinoma (RCC) ranks second in the urinary system tumors in China. About 20-30% of renal cell carcinoma patients are already in advanced stage when diagnosed, and the incidence of postoperative recurrence and metastasis of in situ renal cell carcinoma patients is as high as 30%. Kidney cancer is not sensitive to traditional radiotherapy and chemotherapy, and the effective rate of treatment with cytokines such as interleukin-2 and interferon-α is less than 20%, and the side effects are obvious. Currently, receptor tyrosine kinase (RTK) inhibitors, represented by the small molecule inhibitor sunitinib, are the main treatment for advanced RCC. Sunitinib is a multi-target tyrosine kinase inhibito...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6886C12Q2600/106C12Q2600/158C12Q2600/178
Inventor 曲乐陈程王林辉刘冰吴震杰张雯
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap