Barley leaf rust resistance protein and its coding gene and application
A gene and coding technology, applied in the field of barley leaf rust resistance related protein and its coding gene and application, can solve the problem of short sequence length and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0089] Example 1, Cloning and sequencing of barley leaf rust resistance genes Rlr1 and Rlr2
[0090] The total RNA of barley variety Vada adult plant leaves was extracted with RNAprep Pure Plant Total RNA Extraction Kit (Tiangen), and the total RNA of barley leaves was reverse transcribed into cDNA with reverse transcription kit SuperScriptTMⅢRT (Invitrogen).
[0091] The method for reverse transcription with the reverse transcription kit SuperScriptTMⅢRT (Invitrogen) is as follows:
[0092] (a) Add the following reagents in sequence to the RNA-free PCR tube: Oligo(dT)18 (500μg / ml) 1μl; total RNA 1-5μg; dNTP mix (10mM) 1μl; DEPC H 2 O to make up to 13 μl. Incubate at 65°C for 5 minutes, quickly ice-bath for 2 minutes, and centrifuge slightly.
[0093] (b) Add the following reagents sequentially to the above PCR tube: 4 μl of 5×First-Strand buffer; 1 μl of 0.1M DTT; 1 μl of RNaseOUTTM (40U / μl); 1 μl of SuperScriptTMIII (200U / μl). Reverse transcription at 50°C for 50min.
[...
Embodiment 2
[0102] Expression pattern analysis of embodiment 2, Rlr1 and Rlr2
[0103] The primers for fluorescent quantitative PCR were designed according to the requirement of fluorescent quantitative PCR analysis primers and the CDS sequences of Rlr1 and Rlr2 genes, and the expression of barley ubiquitin conjugating enzyme 18 (Hv-UBC18) gene was used as an internal reference. Primer sequences are shown in Table 1.
[0104] Table 1 Primer sequences used in the analysis of expression patterns of Rlr1 and Rlr2
[0105] Primer name
Primer sequence (5'→3')
Location
Rlr1-QPCR-F
GTACGCTTGCAATACTGACCATC
734-756 of sequence 3
Rlr1-QPCR-R
TCCAAAAGAGACCAGAAGCAATAC
No. 1076-1099 of sequence 3
Rlr2-QPCR-F
ATGCAGCGACGTGGCAC
Positions 1-17 of sequence 4
Rlr2-QPCR-R
GCTCGGAAATTGTCTAGACTG
150-170 of sequence 4
Hv-UBC18-F
CGATGCACCCGCACATTTACAG
Hv-UBC18-R
CGTTGCGGCAGTTCCTAAC
[0106] The barl...
Embodiment 3
[0111] The virus-induced gene silencing (VIGS) experiment of embodiment 3, Rlr1 and Rlr2
[0112] 1. Construction of recombinant vector
[0113] According to the CDS sequences of Rlr1 gene and Rlr2 gene, primers with LIC linkers were designed (see Table 2), and the VIGS fragments of Rlr1 gene and Rlr2 gene were amplified from the leaf cDNA of barley variety Vada, and the sizes were 393bp and 465bp (including LIC Linker sequence) DNA fragments, the band of interest was recovered using Tiangen's gel recovery kit. Simultaneously extract the pCa-γbLIC plasmid (the pCa-γbLIC plasmid contains the DNA sequence corresponding to the γRNA of barley stripe mosaic virus (BMSV), and at the same time introduce the LIC junction site downstream of the γb gene in the plasmid for cloning foreign gene fragments) , and digested with NEB ApaI to linearize the plasmid, and recover the target band (denoted as pCa-γbLIC / ApaI) with Tiangen gel extraction kit.
[0114] Table 2 Primers used in virus-i...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


