A method for increasing the oxytetracycline yield of Streptomyces by gene blockade
A technology of oxytetracycline and Streptomyces fissures, applied in the biological field, can solve problems such as genetic difficulties and complex secondary metabolism regulation network
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0077] Embodiment 1, construction of recombinant plasmid pKCΔsig
[0078] 1. Extraction of genomic DNA containing Streptomyces rimosus: First, Streptomyces rimosus SRI05 was inoculated into trypticase soybean broth (TSB), and cultured at 30° C. and 220 rpm for 30 hours. Next, the mycelium was collected by centrifugation, and the mycelium was washed with sterile water. Then use lysozyme to break the cell wall, and extract with phenol-chloroform to remove impurities such as protein. Finally, genomic DNA was obtained by precipitation with isopropanol.
[0079] 2. Using the M4018 genome as a template, use the following primers to carry out PCR reaction to amplify a partial fragment of lsigB, which is named KB fragment, specifically the DNA fragment from 181bp to 680bp inside the lsigB gene, a total of 500bp:
[0080] K-lsig BF: CGC GGATCC AACCTGCCATTGGTGCGCTACGCG (the underline is the BamHI site) (SEQ ID NO: 7);
[0081] K-lsig BR: CTAG TCTAGA TTGGCCAGCAGGGGCTTGAGGGACT (Xba...
Embodiment 2
[0086] Embodiment 2, screening and identification of mutant strains
[0087] When the pKCΔsig plasmid enters the cell, the resistance gene can express Apr resistance only when the homology arm on the recombinant plasmid is exchanged with the genome to integrate the recombinant plasmid into the genome. At the same time, pKC1139 is a temperature-sensitive plasmid. When the temperature is high, the plasmid cannot be replicated, and the free plasmid will be lost. The sequence on the plasmid can be integrated on the chromosome through homologous exchange, so that the resistance gene can be expressed. Therefore, the transformants were screened under the culture condition of 37°C. At this time, the recombinant bacteria that could grow on the resistance plate were the recombinant bacteria with recombination exchange (pKCΔsig), and the recombinant bacteria were further identified by PCR. The specific process is as follows:
[0088]Combination transfer of Streptomyces chamatis: inocula...
Embodiment 3
[0093] Thalline growth and oxytetracycline fermentation situation in embodiment 3, fermentation process
[0094] During the fermentation process of Streptomyces chamotis M4018, 6ml of fermentation broth was sampled every 12 hours, of which 5ml was used to measure the dry weight of the bacteria, and 1ml was used to determine the yield of oxytetracycline by HPLC, to observe the growth status of the bacteria and the status of oxytetracycline production .
[0095] The oxytetracycline output of the comparison unit cell can be seen ( Figure 4 ), compared with the control strain M4018, the oxytetracycline synthesis of ΔlsigB unit cells increased by about 23.2%.
[0096] In summary, blocking lsigB has a significant positive regulatory effect on the synthesis of oxytetracycline.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More