Target gene capture kit and capture method
A technology of target genes and capture reagents, which is applied in biochemical equipment and methods, microbial measurement/inspection, DNA/RNA fragments, etc., can solve the problems of different coverage depths and incapable of quantitative analysis, and achieve wide coverage, The effect of low cost and deep sequencing depth
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1: Specific probe sets for biotin-labeled target genes
[0058] 1) Design a 150nt specific probe sequence covering the target gene, such as the nucleotide sequence shown in SEQ ID NO.3-SEQ ID NO.1237, synthesized by a biological company (CustomArray, USA) for future use. The specific probe sequence is divided into three parts: 15nt universal linker A-120nt target gene specific sequence-15nt universal linker B, namely ATCGCACCAGCGTGT-120nt-CACTGCGGCTCCTCA
[0059] 2) Use PCR to enrich the content of the probe and connect to the T7 promoter: use Titanium Taq PCR Kit (Clontech)
[0060] The PCR system (50μL system) is:
[0061]
[0062] Primer C is: CTGGGAATCGCACCAGCGTGT
[0063] Primer D is: CGTGGATGAGGAGCCGCAGTG
[0064] Reaction cycle time: 94°C 2min
[0065] 19 cycles: 94°C 30s; 55°C 30s; 72°C 30s
[0066] 72℃ 2min
[0067] The PCR product was purified using Qiagen QIAquick PCR extraction Kit, and the purified product was eluted with 25 μL kit (Titaniu...
Embodiment 2
[0080] Example 2: Capture kit for target gene
[0081] A target gene capture kit consists of the biotin-labeled target gene-specific probe set prepared in Example 1, hybridization mixture, hybridization buffer, washing solution A, washing solution B and eluent.
[0082] Wherein, the hybridization mixture: 500ng / μL human Cot-1 DNA and 500ng / μL salmon sperm DNA;
[0083] 2×hybridization buffer: 10×SSPE buffer, 10×Denhardt’s Solution, 10mM EDTA and 0.1% SDS;
[0084] Washing solution A: 1×SSC / 0.1% SDS;
[0085] Washing solution B: 0.1×SSC / 0.1%SDS;
[0086] Eluent: 0.1M NaOH.
Embodiment 3
[0088] A human whole blood sample genomic DNA library was constructed using the Illumina Standard Library Construction Kit, and 250 ng / μL of 200bp-350bp standard library fragments were obtained.
[0089]Preheat 5 μL of hybridization mixture and 2 μL of standard library fragments, 7 μL of the mixture, at 95°C for 5 minutes, keep at 65°C for 5 minutes, mix with 13 μL of 2-fold hybridization buffer preheated at 65°C, 6 μL of 500ng biotin-labeled The specific probe group of the target gene was mixed with 20 U of the RNase inhibitor SUPERRase-IN, kept at 65°C for 16-18 hours, then 50 μL of streptavidin magnetic bead solution (M-280 streptavidin Dynabeads, Invitrogen) was added, and mixed statically. After standing for 30 minutes, use a magnetic stand to absorb the magnetic beads for 15 minutes, discard the supernatant, add 500 μL of washing solution A, mix at room temperature, use a magnetic stand to absorb the magnetic beads for 15 minutes, and discard the supernatant. Add 500 μL ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More