An immunoelectrochemical sensor for detecting β-amyloid oligomers and its preparation method
A technology of amyloid protein and oligomer, which is applied in the field of biosensing and electroanalytical chemical detection to achieve the effect of improving sensitivity, high selectivity and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Preparation method of an immune-like biosensor for detecting Aβ oligomers
[0030] (1) Conjugation of aptamer and thionine on AuNPs
[0031] A nucleic acid aptamer with a strong binding ability to the Aβ oligomer was selected, its sequence is: GCCTGTGTTGGGGCGGGTGCG, and the 5'SH C6 was modified.
[0032] Preparation of AuNPs solution with a diameter of 20 nm: Add 3.75 mL of 1% (mass percentage) sodium citrate solution to boiling 250 mL of 0.01% (mass percentage) HAuCl under rapid stirring 4 4H 2 O solution, it was observed that the color of the solution would change from light yellow to deep purple within 2 minutes. Keep the mixed solution continuously boiling and stirring for 15 min, and cool to room temperature to obtain the AuNPs solution, which is stored in a refrigerator at 4°C for later use. Then, mix the prepared 7mL AuNPs and 2mL 1mM thionine solution, stir at room temperature for 24h, centrifuge (8000r / min, 15min), remove the lower layer, and then ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



