HRM detecting primers and method for distinguishing foot-mouth disease virus and Seneca Valley virus

A technology for swine foot-and-mouth disease virus and detection method, applied in the field of biological detection, can solve the problems of timely diagnosis and treatment of unfavorable diseases, cumbersome operation methods, time-consuming and labor-intensive, etc., and achieves the effects of high accuracy, high-throughput analysis, and low cost

Active Publication Date: 2016-06-22
SOUTH CHINA AGRI UNIV
View PDF2 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because the clinical symptoms and anatomical symptoms of the disease are very similar to those of foot-and-mouth disease, it is difficult to distinguish them clinically and histopathologically. The differential diagnosis usually requires the help of laboratory diagnostic techniques. Traditional detection methods are time-consuming, laborious, and cumbersome. timely diagnosis and treatment, resulting in significant economic losses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HRM detecting primers and method for distinguishing foot-mouth disease virus and Seneca Valley virus
  • HRM detecting primers and method for distinguishing foot-mouth disease virus and Seneca Valley virus
  • HRM detecting primers and method for distinguishing foot-mouth disease virus and Seneca Valley virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1PCR primer design

[0028] A pair of primers P1 and P2 for amplifying partial gene sequences of porcine foot-and-mouth disease virus and porcine senega valley virus were designed according to the gene sequences of porcine foot-and-mouth disease virus and porcine senega valley virus, and their base sequences are as follows.

[0029] P1: ACTTTTCTGAAAGATGAAAT (SEQ ID NO: 1);

[0030] P2: TTGTCDGCTGGAGTCAT (SEQ ID NO: 2).

Embodiment 2

[0031] The preparation of embodiment 2 standard sample and PCR-HRM analysis thereof

[0032] (1) Extraction of viral RNA:

[0033] The RNA of porcine foot-and-mouth disease virus and porcine senegal virus in the diseased material samples were extracted with Tiangen's automatic nucleic acid extractor. Samples of disease materials can be easily obtained samples such as blister fluid and blister skin without serious harm to the animal body; they can also be tissue samples such as heart and trachea.

[0034] (2) Preparation of plasmid

[0035] The RNAs of porcine foot-and-mouth disease virus and porcine senega valley virus were respectively taken as templates after sequencing, and P1 and P2 were used as primers (0.5 μM) respectively for RT-PCR amplification. The amplification reaction system was:

[0036] Template 1 μL

[0037] 2×1-StepBuffer12.5μL

[0038] PrimeScript1-step Enzyme Mix 0.5 μL

[0039] Primer P11 μL

[0040] Primer P21 μL

[0041] LCgreen dye 1 μL

[0042] ...

Embodiment 3

[0064] Example 3 Clinical Sample PCR-HRM Analysis

[0065] (1) Extract viral RNA from clinical samples: the method is the same as the RNA extraction method in Example 2 above; (2) Use the extracted viral RNA as a template to perform RT-PCR amplification, and the amplification reaction system is:

[0066] Template 1 μL

[0067] 2×1-StepBuffer12.5μL

[0068] PrimeScript1-step Enzyme Mix 0.5 μL

[0069] Primer P11 μL

[0070] Primer P21 μL

[0071] LCgreen dye 1 μL

[0072] wxya 2 O3μL

[0073] The total volume is 20 μL.

[0074] The reaction program of RT-PCR amplification was: (i) 30 min at 50°C; (ii) pre-denaturation at 94°C for 15 min; (iii) denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 45 s; (iii) final denaturation at 72°C. Extend for 10 min, wherein, step (iii) was cycled 35 times; melting curve analysis was performed at a melting rate of 0.3°C / s from 80°C to 93°C.

[0075] HRM analysis was performed on the amplified products...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological detection, and discloses HRM detecting primers and a method for distinguishing the foot-mouth disease virus (FMDV) and the Seneca Valley virus (SVV). The primers have the sequences shown in SEQ ID NO:1 and SEQ ID NO:2 and are high in specificity. By means of the primers, PCR amplification is conducted on the FMDV and the SVV, then fluorescent data is collected by monitoring the combination situation of double-chain DNA fluorescent dyes and PCR amplification products in the temperature rise process in real time, and the FMDV and the SVV are distinguished according to the difference of two dissolution curves; the two gene types can be distinguished after PCR amplification is conducted through the primers, it takes people only 3 hours for the whole operation process, no virus cell culture is needed, and the type distinguishing time is greatly shortened; expanses are low, no specific probe is needed, and fluorescent saturated dyes are low in price and easy to obtain; accuracy, specificity and repeatability are high, analysis can be accurately and rapidly conducted at high throughput, and the primers and method are easy to apply and popularize in clinical practices.

Description

technical field [0001] The invention belongs to the technical field of biological detection, and more specifically relates to an HRM detection primer and a method for distinguishing porcine foot-and-mouth disease virus and porcine senegal virus. Background technique [0002] Foot-and-mouth disease is an acute, febrile, and highly contagious animal disease caused by Foot and Mouth Disease Virus (FMDV), which infects major livestock species such as pigs, cattle, sheep, and other cloven-hoofed animals. The characteristic symptoms of affected pigs were fever, blisters on the snout, hooves and sow teats, sudden onset of acute lameness, tabby heart and hemorrhagic gastroenteritis lesions at necropsy. Foot-and-mouth disease is highly contagious and has a high incidence rate. The International Organization for Animal Health (OIE) lists the disease as the first class A infectious disease; A typical representative of the Senecavirus virus genus. It was initially considered to be a c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/701C12Q2527/107C12Q2563/107
Inventor马静云郭鹏举朱余军伍绮文
OwnerSOUTH CHINA AGRI UNIV