Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method, oligonucleotide and kit for detecting was gene polymorphic mutation site

An oligonucleotide and mutation site technology, applied in the field of life science and biology, can solve the problems of easy misdiagnosis and complex clinical manifestations of WAS syndrome, and achieve the effect of high cost, high detection difficulty, and reduction of cost and difficulty.

Active Publication Date: 2020-08-07
杭州艾迪康医学检验中心有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In summary, the clinical manifestations of WAS syndrome are complex and easy to be misdiagnosed. If not treated early, it will be very fatal to the patient. Therefore, whole exome sequencing of the WAS gene will help early targeted treatment and save the life of the patient. of great significance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method, oligonucleotide and kit for detecting was gene polymorphic mutation site
  • Method, oligonucleotide and kit for detecting was gene polymorphic mutation site
  • Method, oligonucleotide and kit for detecting was gene polymorphic mutation site

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] An oligonucleotide for detecting the polymorphic mutation site of the WAS gene, the oligonucleotide is designed for all exons of the WAS gene, including: amplification primers for detecting the polymorphic mutation site of the WAS gene, Its base sequence is:

[0073] WAS-1 / 2F: TGTAAAACGACGGCCAGTCAAAAGGTGGGTCTAAGCAGTC

[0074] WAS-1 / 2R: AACAGCTATGACCATGCGGGTTGAGAACTGGCTTG

[0075] WAS-3 / 4 / 5 / 6F: TGTAAAACGACGGCCAGTGAGCTGAAAATCTCCAAACCA

[0076] WAS-3 / 4 / 5 / 6R: AACAGCTATGACCATGTATCCATTCACCCACTTACGC

[0077] WAS-7F: TGTAAAACGACGGCCAGTTACCTCCATGACCATCCAACA

[0078] WAS-7R: AACAGCTATGACCATGCAGCCCTGCACCTACCTATC

[0079] WAS-8 / 9F: TGTAAAACGACGGCCAGTGAGGGCAAGAGGGTTTCACTA

[0080] WAS-8 / 9R: AACAGCTATGACCATGGCCTCAGTTTTGCTCATTTGT

[0081] WAS-10 / 11F: TGTAAAACGACGGCCAGTACCCCATTTTACAAATGAGCAAA

[0082] WAS-10 / 11R: AACAGCTATGACCATGGGTGACTGCTGGGATTGTTT

[0083] WAS-12F: TGTAAAACGACGGCCAGTTTCTTGTCCCAAATGGAAACTC

[0084] WAS-12R: AACAGCTATGACCATGGGCAGAAGGAAACAAAGAAATA.

[0085] In...

Embodiment 2

[0096] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):

[0097](1) Extract tissue DNA from blood: 1) Extract 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inverting, and place at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12,000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed. 2) Add 20 μl proteinase K solution and mix well. 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap. 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap. 5) Add the solution and flocculent precipitate obtained in the previous step i...

Embodiment 3

[0123] Three cases of clinical blood samples (sample number 1-3) were taken according to the reagents and methods of Examples 1 and 2 to extract genome, prepare reagents, amplify and sequence. Each sample obtained its own DNA solution according to Example 2, and then added 1 μl of DNA solution to the PCR reaction solution of the detection system prepared according to Example 2, first amplified, and then electrophoresed the amplified product. Electrophoresis results such as figure 2 Shown, show that the primers of the present invention are paired to WAS-1 / 2F and WAS-1 / 2R, WAS-3 / 4 / 5 / 6F and WAS-3 / 4 / 5 / 6R, WAS-7F and WAS-7R, WAS- 8 / 9F and WAS-8 / 9R, WAS-10 / 11F and WAS-10 / 11R, WAS-12F and WAS-12R can effectively amplify blood samples with a single band.

[0124] The test results of sample 1 are as follows: image 3 , 4 , 5, 6, 7, and 8 show:

[0125] image 3 It shows the wild-type sequencing screenshots of exons 1 and 2 of the WAS gene of sample 1, indicating that exons 1 and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method, oligonucleotide and kit for detecting a polymorphic mutation site of a WAS gene of a patient with an X-linked recessive inheritance immunodeficiency disease, namely Wiskott-Aldrich Syndrome (WAS syndrome). According to the oligonucleotide, the method and the kit, specific amplification primers and sequencing primers are utilized for detecting the polymorphic hot spot mutation of the WAS gene; the mutation of all exons of the WAS gene in the patients with the WAS syndrome can be rapidly detected; the detection result is accurate, the diagnosis of the WAS syndrome can be assisted; the method, the oligonucleotide and the kit have important significances to the early intervention and treatment.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, in particular to primers, methods and kits for detecting polymorphic mutation sites of WAS genes. Background technique [0002] Wiskott-Aldrich Syndrome (WAS), also known as eczema with thrombocytopenia, immunodeficiency syndrome, is an X-linked recessive genetic immunodeficiency disease characterized by platelet count Decreased platelet size, eczema, repeated infection, susceptibility to malignant tumors and autoimmune venereal diseases, if not treated in time, patients with WAS syndrome are prone to die before puberty. [0003] WAS syndrome is a single gene defect disorder. In 1994, researchers isolated the disease-causing gene WAS through positional cloning technology. The gene is located on the X chromosome, contains 12 exons, has a total length of 9 kb, and encodes a total of 502 amino acids. The protein encoded by the WAS gene has five functional regions, which are the PH re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6858C12Q1/6883C12N15/11
CPCC12Q1/6858C12Q1/6883C12Q2600/156C12Q2600/16C12Q2537/143C12Q2525/191
Inventor 林筱剑刘赵玲王淑一
Owner 杭州艾迪康医学检验中心有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com