Unlock instant, AI-driven research and patent intelligence for your innovation.

Vector capable of inhibiting cytochrome P450 gene expression and application of vector capable of inhibiting cytochrome P450 gene expression

A technology for inhibiting cell and plant expression vectors. It can be used in applications, genetic engineering, and introduction of foreign genetic material using vectors. It can solve problems such as death, inability to degrade bentazon in vivo, and plant death, and achieve the effect of preventing transgene escape.

Active Publication Date: 2016-08-24
HAINAN BOLIAN RICE GENE TECH CO LTD
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The mutation of the CYP81A6 gene causes the above mutants to be unable to degrade bendazone in vivo, resulting in plant death when spraying bendazone herbicide
At the same time, the cytochrome P450 is also the target of sulfonylurea herbicides. Plants containing CYP81A 6 mutant gene or bendazone-sensitive plants will also cause death when sprayed with sulfonylurea herbicides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vector capable of inhibiting cytochrome P450 gene expression and application of vector capable of inhibiting cytochrome P450 gene expression
  • Vector capable of inhibiting cytochrome P450 gene expression and application of vector capable of inhibiting cytochrome P450 gene expression
  • Vector capable of inhibiting cytochrome P450 gene expression and application of vector capable of inhibiting cytochrome P450 gene expression

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] The acquisition of embodiment 1 bacterial strain, plasmid and the synthesis of PCR primer

[0048] (1) Strains and plasmids

[0049] The plant binary transformation vector pTCK303 as backbone vector contains hygromycin resistance gene, maize Ubi promoter and NOS terminator; pMD18-T cloning vector (Takara). The strain of Escherichia coli is DH5α; the strain of Agrobacterium tumefacieus is EHA105.

[0050] (2) PCR primer sequence

[0051] The enzyme cutting sites of the forward primer were designed as Kpn Ⅰ and Cla Ⅰ, and the enzyme cutting sites of the reverse primer were Xhol Ⅰ and BamH Ⅰ.

[0052] P450RNAi-F3GGGGTACCATCGATCGCATCCGTCGGCAAC

[0053] P450RNAi-R3 CCGCTCGAGGGATCCGGCCTGCACATGGCCT

Embodiment 2

[0054] Construction and transformation of embodiment 2RNAi plant expression vector

[0055] In order to construct the interference vector of cytochrome P450 gene CYP81A6, rice cDNA was used as a template, and the P450i-3 gene fragment was amplified by PCR using the primers in Example 1. The amplification system and procedures are as follows:

[0056] Program: Pre-denaturation at 94°C for 5-10min, denaturation at 94°C for 30s, annealing at 59°C for 30s, extension at 72°C for 30s, 30-35 cycles, extension at 72°C for 30s; end at 16°C.

[0057]

[0058]

[0059] A 471bp gene fragment with the expected size was amplified. After recovery, it was connected to the pMD18-T vector (Takara) and named pMD18-T-P450i-3. The sequence of the fragment was verified to be correct by sequencing. The plant binary transformation vector used is pTCK303 (such as figure 1 As shown in A), cut the pTCK303 vector and pMD18-T-P450i-3 respectively according to the enzyme cutting site, and connect t...

Embodiment 3

[0060] Embodiment 3 Agrobacterium transformed rice and identification of transgenic plants

[0061] The pTCK303-P450i-3 recombinant plasmid was introduced into the Agrobacterium EHA105 strain, and the callus of japonica rice Zhonghua 11 was transformed. After hygromycin resistance screening, differentiation, and rooting, 25 regenerated transgenic lines were obtained, and the transgenic plants were identified by PCR. The hygromycin resistance gene was introduced, and the results showed that 20 PCR positive plants ( image 3 ), the positive plants were transplanted into the soil, and 17 survived.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an RNAi plant expression vector capable of inhibiting cytochrome P450 gene expression and a construction method of the RNAi plant expression vector capable of inhibiting cytochrome P450 gene expression as well as a method for interfering plant cytochrome P450 gene CYP81A6 expression and a method for obtaining plants dominantly sensitive to herbicides. When used for rice transformation, the RNAi plant expression vector succeeds in inhibiting gene CYP81A6 expression and transforming rice from resistance to the herbicides to sensitivity to the same, so that the rice dominantly sensitive to the herbicides is cultivated, and sensitive plants can be removed by application of the herbicides. The rice is of great value in new transgenic species cultivation, hybrid rice seed production, transgenic escape prevention and the like.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and in particular relates to an RNAi plant expression vector for inhibiting the expression of cytochrome P450 gene and its construction method and application. Background technique [0002] The utilization of crop heterosis is one of the important means to increase agricultural production. Rice is one of the most important food crops in the world, with obvious heterosis. China is the first country in the world to successfully realize the commercial production of hybrid rice. Hybrid rice has increased my country's rice production by 20%. The annual planting area of ​​hybrid rice in the country has exceeded 50% of the annual planting area of ​​rice. The "three-line method" and "two-line method" are currently the main methods for hybrid rice seed production, but due to the genotype limitation of the three-line nucleoplasmic interaction and the instability of the light and temperature sensi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/66A01H5/00
CPCC12N15/8205C12N15/8216C12N15/8274C12N15/8278
Inventor 黄培劲安保光欧阳超陈思兰吴永忠
Owner HAINAN BOLIAN RICE GENE TECH CO LTD