Normal-temperature stable PCR premixed solution
A technology of premix and buffer, applied in the field of PCR experiments, can solve the problems of short storage time of PCR premix
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] This embodiment compares different combinations of sodium azide, 1,2,4-triazole, glycerol and Tris buffer, and studies the storage time of different PCR premixes at room temperature.
[0029] Several PCR buffers were prepared and tested with the primer probe of Listeria monocytogenes (quoted from the entry-exit standard SN / T 1870-2007); the amplification program was: 95°C for 15min; 93°C for 15s, 58°C for 35s , 40 cycles.
[0030] The primer probes of the above-mentioned Listeria monocytogenes are respectively:
[0031] The upstream primers are: CTGAATCTCAAGCAAAACCTGGT,
[0032] The downstream primers are: CGCGACCGAAGCCAACTA,
[0033] The probe is: 5'6-Fam-ATACGATAACATCCACGGCTCTGGCTGG-3'BHQ1.
[0034] Prepare several different reagent combinations (premixes) according to the table below:
[0035] Table 1: Master Mix Recipe
[0036]
[0037]
[0038] Prepare the above reagent combinations A, B, C, D, E, and place them at room temperature. The Listeria monocyt...
Embodiment 2
[0041] In this example, different combinations of sodium azide, 1,2,4-triazole, glycerol, DMSO and Tris buffer were compared, and the storage time of different PCR premixes at room temperature was studied.
[0042] Several PCR buffers were prepared and tested with common primer probes for Salmonella (quoted from entry-exit standard SN / T 1059.7-2010); the amplification program was: 95°C for 15min; 93°C for 15s, 58°C for 35s, 40 cycle.
[0043] The above-mentioned Salmonella universal primer probe is:
[0044] The upstream primers are: CTCACCAGGAGATTACAACATGG,
[0045] The downstream primers are: AGCTCAGACCAAAAGTGACCATC,
[0046] The probe is: 5'6-Fam-CACCGACGGCGAGACCGACTTT-3'BHQ1. Prepare several different reagent combinations (master mixes) according to the table below.
[0047] Table 2: Master Mix Recipe
[0048]
[0049]Prepare the above reagent combinations F, G, H, I, J and place them in a room temperature environment. Salmonella paratyphi B (product number BNCC10...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 