Normal-temperature stable PCR premixed solution

A technology of premix and buffer, applied in the field of PCR experiments, can solve the problems of short storage time of PCR premix

Active Publication Date: 2016-09-07
安陆市疾病预防控制中心
View PDF4 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] An object of the present invention is to provide a PCR premix that can be stably stored at room temperature for more than 144 hours by adding several mixed compounds in order to solve the problem of short storage time of the existing PCR premix at room temperature

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Normal-temperature stable PCR premixed solution
  • Normal-temperature stable PCR premixed solution
  • Normal-temperature stable PCR premixed solution

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] This embodiment compares different combinations of sodium azide, 1,2,4-triazole, glycerol and Tris buffer, and studies the storage time of different PCR premixes at room temperature.

[0029] Several PCR buffers were prepared and tested with the primer probe of Listeria monocytogenes (quoted from the entry-exit standard SN / T 1870-2007); the amplification program was: 95°C for 15min; 93°C for 15s, 58°C for 35s , 40 cycles.

[0030] The primer probes of the above-mentioned Listeria monocytogenes are respectively:

[0031] The upstream primers are: CTGAATCTCAAGCAAAACCTGGT,

[0032] The downstream primers are: CGCGACCGAAGCCAACTA,

[0033] The probe is: 5'6-Fam-ATACGATAACATCCACGGCTCTGGCTGG-3'BHQ1.

[0034] Prepare several different reagent combinations (premixes) according to the table below:

[0035] Table 1: Master Mix Recipe

[0036]

[0037]

[0038] Prepare the above reagent combinations A, B, C, D, E, and place them at room temperature. The Listeria monocyt...

Embodiment 2

[0041] In this example, different combinations of sodium azide, 1,2,4-triazole, glycerol, DMSO and Tris buffer were compared, and the storage time of different PCR premixes at room temperature was studied.

[0042] Several PCR buffers were prepared and tested with common primer probes for Salmonella (quoted from entry-exit standard SN / T 1059.7-2010); the amplification program was: 95°C for 15min; 93°C for 15s, 58°C for 35s, 40 cycle.

[0043] The above-mentioned Salmonella universal primer probe is:

[0044] The upstream primers are: CTCACCAGGAGATTACAACATGG,

[0045] The downstream primers are: AGCTCAGACCAAAAGTGACCATC,

[0046] The probe is: 5'6-Fam-CACCGACGGCGAGACCGACTTT-3'BHQ1. Prepare several different reagent combinations (master mixes) according to the table below.

[0047] Table 2: Master Mix Recipe

[0048]

[0049]Prepare the above reagent combinations F, G, H, I, J and place them in a room temperature environment. Salmonella paratyphi B (product number BNCC10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of biology, and relates to a PCR (Polymerase Chain Reaction) experiment. Particularly, the invention provides a PCR premixed solution, which comprises Taq polymerase, a buffer solution, dNTP, glycerin, sodium azide and 1, 2, 4-triazole and the like. The PCR premixed solution provided by the invention can stably exist for more than 144 hours at normal temperature; the work efficiency is improved; and the cost is reduced.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to PCR experiments. Background technique [0002] With the development of PCR technology, various PCR kits have appeared on the market for in vitro diagnosis and animal disease monitoring. Some companies try to add Taq enzyme to PCR reagents to form a PCR master mix, which is convenient for customers to operate. Therefore, the PCR master mix usually includes the necessary components such as dNTP, Taq enzyme and buffer. [0003] However, the existing PCR premix solution can only effectively amplify within 4-5 hours at room temperature, and the performance will be greatly lost after being placed at room temperature for more than 5 hours. [0004] Some PCR reagents often add 0.02% to 0.09% sodium azide as a reagent preservative. The antiseptic mechanism of sodium azide is related to its toxicity. Like cyanide, sodium azide inhibits cytochrome oxidase and other enzymes. Although sodium az...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 疏义林张守德
Owner 安陆市疾病预防控制中心
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap