Long non-coding RNA and applications of long non-coding RNA in diagnosis/treatment of non-small cell lung cancer
A non-small cell lung cancer, non-coding technology, used in DNA/RNA fragments, gene therapy, recombinant DNA technology, etc., can solve the problems of low survival rate, poor chemotherapy regimen for lung cancer, and lost opportunities for surgery.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1 Basic verification test of LINC00111 expression level in non-small cell lung cancer
[0035] (1): LINC00111 expression in normal lung tissue and lung cancer tissue
[0036] 1. Chip preparation and analysis: Normal lung tissue and lung cancer tissue samples were prepared according to the requirements of Boao Biological Co., Ltd., and submitted to Boao Biological Co., Ltd. for chip preparation, and the human long-chain non-coding RNA chip V1.0 version completed the chip analysis.
[0037] 2. Microarray analysis: The expression level of LINC00111 in lung cancer was up-regulated by 29.08 times compared with normal lung tissue, suggesting that LINC00111 may function as an oncogene in lung cancer.
[0038] (2): qRT-PCR analysis of the expression of LINC00111 in normal lung epithelial cell line 16HBE and non-small cell lung cancer cell line A549
[0039] 1. Methods: Trizol reagent was used to extract total cellular RNA, and qRT-PCR was performed using SYBR Green PCR M...
Embodiment 2
[0042] Example 2 The therapeutic effect of inhibiting the expression of LINC00111 on non-small cell lung cancer
[0043] 1. Detection of cell apoptosis by flow cytometry:
[0044] The nucleotide sequence of the siRNA of LINC00111 is shown in SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6:
[0045] SEQ ID NO: 4 CAGTGGCTCCAGGTGTAACCCATTT
[0046] SEQ ID NO: 5 GGGATGTTCTGGTGAAGGATCTGAA
[0047] SEQ ID NO: 6 CAACATCAGGAGATCTGACTTCATA
[0048] The sequence fragments that interfere with the GAPDH gene were used as a control, and inserted into a lentiviral vector (the above vectors and fragments were synthesized by Invitrogen). The packaged lentiviral vector was used to infect the non-small cell lung cancer cell line A549 to down-regulate the expression of LINC00111. After 48 hours, the stably transfected cell line was screened with G418 and named A549 / si-LINC00111 (the control was A549 / si- NC). The si-LINC00111 lentiviral interference vector was constructed to infect the A549 cell ...
Embodiment 3
[0054] Example 3 Experiments related to cell drug resistance
[0055] 1. MTT test cell IC50: Construct LINC00111 lentiviral interference vector to transfect A549 cell line (A549 / si-LINC00111), and empty vector to transfect A549 cell line (A549 / si-NC) as the control group. These cell lines were seeded on 96-well plates at 2500 cells / well. Each group was treated with cisplatin or docetaxel, and the cell viability was detected by MTT staining 3 days after administration, and then the IC50 of each drug was calculated.
[0056] 2. Results determination: if figure 2 , 3 shown.
[0057] 3. Analysis of the results: In the A549 cell line, the IC50 of the si-LINC00111 experimental group treated with DDP: 11.01ug / ml, the IC50 (NC) of the control group: 23.26ug / ml; the A549 / si-LINC00111 experimental group treated with DTX IC50: 13.42ug / ml, IC50(NC) of the control group: 25.69ug / ml. This phenomenon was observed, suggesting that reducing the expression of LINC00111 can promote the apo...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
