Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Type 33 recombinant human papillomavirus virus-like particle and preparation method thereof

A human papillomavirus and fusion gene technology, applied in the field of 33 recombinant human papillomavirus virus-like particles and its preparation, can solve the problems of large protein loss, difficulty in large-scale production and low yield, and achieve Prevention of infection, good immunogenicity effect

Active Publication Date: 2021-06-11
BEIJING HEALTH GUARD BIOTECH
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in these purification processes, the protein loss is large and the yield is low, which makes it difficult to apply in large-scale production.
[0006] In terms of the uniformity of the HPV vaccine antigen protein VLP, the particle size dispersion of the HPV L1 VLP assembled in the prior art is represented by the polyd value, and the polyd value <15% indicates that the particles have good uniformity, and 15% to 30 % means that the particles have greater heterogeneity, and greater than 30% means that the particles are not uniform at all
Most HPV L1 VLPs prepared in the prior art are greater than 15%

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Type 33 recombinant human papillomavirus virus-like particle and preparation method thereof
  • Type 33 recombinant human papillomavirus virus-like particle and preparation method thereof
  • Type 33 recombinant human papillomavirus virus-like particle and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment l

[0067] Embodiment 1: the design and synthesis of the HPV L1 gene of codon optimization

[0068] The gene sequences were derived from the various types of HPV sequences published on PUBMED. All HPV DNA sequences were synthesized after codon optimization of the selected HPV DNA sequences according to the codon preference of Escherichia coli for gene transcription. Primers were designed according to the synthetic DNA sequence, and the synthetic gene was used as a template for PCR amplification. The resulting codon-optimized sequences were verified by DNA sequencing.

[0069] DNA sequences of various types of HPV before and after optimization:

[0070] SEQ NO.1: DNA sequence of HPV33 type L1 before optimization

[0071] SEQ NO.2: DNA sequence of optimized HPV33 type L1

Embodiment 2

[0072] Example 2: Construction and identification of recombinant vector pGEX-6P-1-GST-HPV33 L1:

[0073] Primers for amplifying the DNA fragment of HPV33 L1: (the restriction sites are BamHI and XhoI, respectively)

[0074] Forward-HPV33 L1-ApaI: 5' ACTTCAGGATCC ATGTCTGTTTGGCGTCCGTCTG

[0075] Reverse-HPV33 L1-XhoI: 5'ATCTCACTCGAGCTA TTTTTTAACTTTTTTACGTTT

[0076] PCR amplification reaction system: 10 x Pfu buffer 20 μL, Pfu enzyme 4 μL, 10 mM dNTP 2.5 μL, 5’Primer (5 μM) 10 μL, 3’ Primer (5 μM) 10 μL, template DNA 50 ng, add d 2 h 2 0 to 200 μL.

[0077] Gene PCR amplification conditions: 95°C for 3 min; 95°C for 30 sec, 58°C for 30 sec, 72°C for 4 min; cycle 32 times; 72°C for 10 min.

[0078] The L1 gene fragment containing BamH I and XhoI restriction sites and the vector pGEX-6P-1 were subjected to BamH I / XhoI double digestion treatment, and then the recovered gene fragment was combined with pGEX-6P-1 containing the corresponding cohesive end using T4 DNA ligase. 6P-1...

Embodiment 3

[0081] Example 3: Construction of recombinant vector pGEX-6P-1m-GST-SUMO-HPV33 L1 vector

[0082] Construction of pGEX-6p-1m vector: In order to make the ApaI restriction site (GGGCCC) near the multi-restriction site the only ApaI restriction site of the vector, point mutation was carried out without changing the protein expression sequence of the lacI gene ApaI (3890) can be eliminated by changing the Gly codon GGC in another ApaI recognition sequence GGGCCC of the commercially available pGEX-6p-1 vector to its synonymous codon GGT. Through such modification, ApaI can be used to insert and express genes.

[0083] Primers for amplifying the DNA fragment of SUMO: (restriction sites are ApaI and BamHI respectively)

[0084] Forward-SUMO-ApaI: ACTTCAGGGCCCTCTGACCAGGAAGCTAAACCGTC

[0085] Reverse-SUMO-BamHI: CGCGGATCCACCGGTCTGTTCCTGGTAAAC

[0086] Primers for amplifying the DNA fragment of HPV33 L1: (the restriction sites are BamHI and XhoI, respectively)

[0087] Forward-HPV3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The present invention relates to type 33 recombinant human papillomavirus virus-like particles and a preparation method thereof. The specific technical point is to provide a new polynucleotide gene fragment encoding a recombinant HPV33 L1 protein, a vector comprising the gene fragment, and a vector including the vector. Host cells, as well as the HPV33 L1 fusion protein, pentamer and VLP composed of the pentamer translated and expressed by the gene fragment, the present invention also discloses that the pentamer, the VLP protein and the vaccine composition composed of the pentamer are used in the preparation of prevention Drug application in HPV33 infection.

Description

technical field [0001] The invention relates to a virus-like particle of human papillomavirus and a preparation method thereof. More specifically, the present invention relates to a pentamer of recombinant human papillomavirus L1 protein and a virus-like particle (Virus-like Particle, VLP) and a preparation method thereof, and a vaccine composition containing the virus-like particle in Use in the prevention of human papillomavirus infection. Background technique [0002] Human papillomavirus (HPV) mainly through close contact with human body, such as sexually transmitted virus, can cause a variety of proliferative epithelial lesions in humans, including papilloma (wart) and tumor-like lesions. Specifically, HPV-induced diseases mainly include 3 categories, category 1: cancers of the cervix, vagina, female vulva, penis and anus, and certain types of malignant lesions such as head and neck tumors. 100% of cervical cancer patients are caused by HPV infection, 90% of anal canc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/37C12N15/70C12N1/21C12N7/04C07K14/025C07K19/00A61K39/12A61K38/16A61P31/20
Inventor 刘永江伍树明高文双陈晓任永峰王雅君姜绪林张瑞霞高俊张海江陈建平银飞徐岚仉春艳夏丽
Owner BEIJING HEALTH GUARD BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com