Type 33 recombinant human papillomavirus virus-like particle and preparation method thereof
A human papillomavirus and fusion gene technology, applied in the field of 33 recombinant human papillomavirus virus-like particles and its preparation, can solve the problems of large protein loss, difficulty in large-scale production and low yield, and achieve Prevention of infection, good immunogenicity effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment l
[0067] Embodiment 1: the design and synthesis of the HPV L1 gene of codon optimization
[0068] The gene sequences were derived from the various types of HPV sequences published on PUBMED. All HPV DNA sequences were synthesized after codon optimization of the selected HPV DNA sequences according to the codon preference of Escherichia coli for gene transcription. Primers were designed according to the synthetic DNA sequence, and the synthetic gene was used as a template for PCR amplification. The resulting codon-optimized sequences were verified by DNA sequencing.
[0069] DNA sequences of various types of HPV before and after optimization:
[0070] SEQ NO.1: DNA sequence of HPV33 type L1 before optimization
[0071] SEQ NO.2: DNA sequence of optimized HPV33 type L1
Embodiment 2
[0072] Example 2: Construction and identification of recombinant vector pGEX-6P-1-GST-HPV33 L1:
[0073] Primers for amplifying the DNA fragment of HPV33 L1: (the restriction sites are BamHI and XhoI, respectively)
[0074] Forward-HPV33 L1-ApaI: 5' ACTTCAGGATCC ATGTCTGTTTGGCGTCCGTCTG
[0075] Reverse-HPV33 L1-XhoI: 5'ATCTCACTCGAGCTA TTTTTTAACTTTTTTACGTTT
[0076] PCR amplification reaction system: 10 x Pfu buffer 20 μL, Pfu enzyme 4 μL, 10 mM dNTP 2.5 μL, 5’Primer (5 μM) 10 μL, 3’ Primer (5 μM) 10 μL, template DNA 50 ng, add d 2 h 2 0 to 200 μL.
[0077] Gene PCR amplification conditions: 95°C for 3 min; 95°C for 30 sec, 58°C for 30 sec, 72°C for 4 min; cycle 32 times; 72°C for 10 min.
[0078] The L1 gene fragment containing BamH I and XhoI restriction sites and the vector pGEX-6P-1 were subjected to BamH I / XhoI double digestion treatment, and then the recovered gene fragment was combined with pGEX-6P-1 containing the corresponding cohesive end using T4 DNA ligase. 6P-1...
Embodiment 3
[0081] Example 3: Construction of recombinant vector pGEX-6P-1m-GST-SUMO-HPV33 L1 vector
[0082] Construction of pGEX-6p-1m vector: In order to make the ApaI restriction site (GGGCCC) near the multi-restriction site the only ApaI restriction site of the vector, point mutation was carried out without changing the protein expression sequence of the lacI gene ApaI (3890) can be eliminated by changing the Gly codon GGC in another ApaI recognition sequence GGGCCC of the commercially available pGEX-6p-1 vector to its synonymous codon GGT. Through such modification, ApaI can be used to insert and express genes.
[0083] Primers for amplifying the DNA fragment of SUMO: (restriction sites are ApaI and BamHI respectively)
[0084] Forward-SUMO-ApaI: ACTTCAGGGCCCTCTGACCAGGAAGCTAAACCGTC
[0085] Reverse-SUMO-BamHI: CGCGGATCCACCGGTCTGTTCCTGGTAAAC
[0086] Primers for amplifying the DNA fragment of HPV33 L1: (the restriction sites are BamHI and XhoI, respectively)
[0087] Forward-HPV3...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



