Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit and method for detecting drug-resistant mutation site of helicobacter pylori

A drug-resistant mutation site, Helicobacter pylori technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of time-consuming, complicated operation, and difficult cultivation of Helicobacter pylori

Inactive Publication Date: 2017-02-15
JIANGSU MOLE BIOSCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Helicobacter pylori is a helical, slightly anaerobic, Gram-negative bacillus that requires very harsh growth conditions. Therefore, the cultivation of Helicobacter pylori is difficult, complicated, and time-consuming (the whole process of drug susceptibility testing Usually takes 1-2 weeks)
Therefore, the cost of the drug sensitivity test of Helicobacter pylori is high and the sensitivity is low, and it is particularly difficult to meet the requirements of clinical detection of drug resistance to the commonly used drugs clarithromycin and quinolone antibiotics of Helicobacter pylori

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for detecting drug-resistant mutation site of helicobacter pylori
  • Kit and method for detecting drug-resistant mutation site of helicobacter pylori
  • Kit and method for detecting drug-resistant mutation site of helicobacter pylori

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] Example 1 Detection of the drug resistance of the kit of the present invention to the 259 site mutation of Helicobacter pylori gyrA gene

[0085]1. Determination of test samples

[0086] The clinical samples that were detected as Helicobacter pylori quinolone resistance by drug susceptibility test and proved to be mutated from A to T at the gyrA259 site by sequencing comparison were used as samples to be tested. Helicobacter pylori genomic DNA was extracted by column method or magnetic bead method, and stored at -80°C after aliquoting.

[0087] 2. Design of primers and probes:

[0088] Multiple pairs of primers and probes are designed, and the length of the primers is generally 15-30 bases.

[0089] The A259T primer probe and blocking sequence of the gyrA drug-resistant mutation site of Helicobacter pylori quinolone gene are as follows:

[0090] Upstream primer 259-F: 5'ACCACCCCCCATGGCGATT3'

[0091] Downstream primer 259-R: 5'CGCCATCAATAGAGCCAAAGTG3'

[0092] Prob...

Embodiment 2

[0109] Example 2 Detection of the drug resistance of the kit of the present invention to the 261 site mutation of Helicobacter pylori gyrA gene

[0110] 1. Determination of test samples

[0111] The clinical samples that were detected as Helicobacter pylori quinolone resistance by drug susceptibility test and proved to be mutated from T to G at the gyrA261 site by sequencing comparison were used as samples to be tested. Bacterial genomic DNA was extracted by column method or magnetic bead method, and stored at -80°C after aliquoting.

[0112] 2. Design of primers and probes:

[0113] Multiple pairs of primers and probes are designed, and the length of the primers is generally 15-30 bases.

[0114] In this example, the T261G primer probe and blocking sequence of the Helicobacter pylori quinolone gene gyrA drug-resistant mutation site are as follows:

[0115] 261-F: 5'ACCACCCCCCATGGCGATTAG3'

[0116] 261-R: 5'CGCCATCAATAGAGCCAAAGTG3'

[0117] 261-P: 5'HEXGAGAATGGCGCAAGATTTT...

Embodiment 3

[0135] Example 3 Detection of the drug resistance of the kit of the present invention to the 271 site mutation of Helicobacter pylori gyrA gene

[0136] 1. Determination of test samples

[0137] The clinical samples that were detected as Helicobacter pylori quinolone resistance by drug susceptibility test and proved to be mutated from G to A at the gyrA271 site by sequencing comparison were used as samples to be tested. Bacterial genomic DNA was extracted by column method or magnetic bead method, and stored at -80°C after aliquoting.

[0138] 2. Design of primers and probes:

[0139] Multiple pairs of primers and probes are designed, and the length of the primers is generally 15-30 bases.

[0140] In this example, the G271A primer probe and blocking sequence of the gyrA drug-resistant mutation site of Helicobacter pylori quinolone gene are as follows:

[0141] 271A-F: 5'CCATGGCGATAATGCGGTTTTTA3'

[0142] 271A-R: 5'CGCCATCAATAGAGCCAAAGTG3'

[0143] 271A-P: 5'HEXGAGAATGGCGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a kit and a method for detecting drug-resistant a mutation site of helicobacter pylori. The kit comprises a quinolone antibiotic drug-resistant mutation site mutation primer probe and the retardant sequence and / or a clarithromycin antibiotics drug-resistant mutation site mutation primer probe and the retardant sequence and / or a PRC reagent panel which is matched with the probes above. The detection method comprises the kit, and fluorescent PCR can be adopted to detect whether drug resistance mutation occurs in a tested sample. The detection method is high in sensitivity, strong in specificity, short in time consumption, and has a great advantage in clinical detection of drug resistance of helicobacter pylori.

Description

technical field [0001] The invention belongs to the field of biological products, in particular to a kit and a method for detecting drug-resistant mutation sites of Helicobacter pylori. Background technique [0002] Helicobacter pylori (Hp) is the most widespread pathogen in the world, about 50% of the world's people are infected with Helicobacter pylori, and in my country, 40%-70% of the population is infected with Helicobacter pylori. Helicobacter pylori mainly causes diseases related to the digestive system of the gastrointestinal tract, such as chronic gastritis, gastric ulcer, duodenal ulcer, gastric cancer and so on. At present, the treatment of Helicobacter pylori mainly adopts triple or quadruple therapy containing antibiotics, and with the extensive use of antibiotics, Helicobacter pylori has become resistant to antibiotics. Therefore, the detection of drug resistance of Helicobacter pylori is of great significance for the guidance of clinical medication. [0003]...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/689C12Q2600/156
Inventor 吕棠山王伟伟李杨霞陈文铎
Owner JIANGSU MOLE BIOSCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com