Unlock instant, AI-driven research and patent intelligence for your innovation.

Specific primer combination for identifying chicken parvovirus and application thereof

A chicken parvovirus and primer combination technology, applied in the directions of microorganisms, recombinant DNA technology, microorganism-based methods, etc., can solve the problems of time-consuming, labor-intensive, sensitivity, low, etc., and achieve good specificity, high sensitivity, and good specificity. Effect

Inactive Publication Date: 2017-02-22
GUANGXI VETERINARY RES INST
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the methods for identifying viruses mainly rely on traditional virus isolation, agar diffusion test and ELISA, etc. These methods usually have the disadvantages of time-consuming, laborious and low sensitivity.
At present, there is no research report on the establishment of ChPV semi-nested PCR detection method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer combination for identifying chicken parvovirus and application thereof
  • Specific primer combination for identifying chicken parvovirus and application thereof
  • Specific primer combination for identifying chicken parvovirus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] Embodiment 1, primer design

[0076] A large number of sequence analyzes and comparisons were carried out to obtain several primers for identifying chicken parvovirus. Preliminary experiments were performed on each primer to compare performances such as sensitivity and specificity, and finally a set of primer combinations for identifying chicken parvovirus was obtained.

[0077] The specific primer pair used to identify chicken parvovirus consists of the following three primers (5'→3'):

[0078] ChPV-F1 (Sequence 1 of the Sequence Listing): ATAACGATATCACTCAAGTTTCCAA;

[0079] ChPV-F2 (SEQ ID NO: 2 of the Sequence Listing): GCTGCAATCAGAGCAAGATG;

[0080] ChPV-R (SEQ ID NO: 3 of the SEQUENCE LISTING): GGGTTGGTTAAATGGCAAAG.

Embodiment 2

[0081] Embodiment 2, semi-nested PCR reaction condition optimization

[0082] 1. Extract the genomic DNA of chicken parvovirus.

[0083] 2. Take the genomic DNA obtained in step 1 as a template, and use the primer combination prepared in Example 1 to carry out semi-nested PCR.

[0084] (1) Using the genomic DNA obtained in step 1 as a template, use primer ChPV-F1 and primer ChPV-R to carry out the first round of PCR amplification:

[0085] Reaction system for the first round of PCR (25.0 μL): 12.5 μL of 2×PCR Mix, 1 μL of template (DNA content: 5.62 ng), 1 μL each of ChPV-F1 and ChPV-R, and finally use ddH 2 O to make up to 25.0 μL. In the first round of PCR reaction system, the concentrations of ChPV-F1 and ChPV-R were both 10 pmol / μL.

[0086] The reaction program of the first round of PCR: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 15 s, annealing for 30 s, a total of 30 cycles, and extension at 68°C for 10 min.

[0087] Set the annealing temperature a...

Embodiment 3

[0116] Embodiment 3, specificity

[0117] 1. Extract the genomic DNA of the sample to be tested. The samples to be tested are: chicken parvovirus (ChPV), Marek virus (MDV), and infectious laryngotracheitis virus (ILTV).

[0118] 2. Extract the total RNA of the sample to be tested and reverse transcribe it into cDNA. The samples to be tested are: Newcastle Disease Virus (NDV), H9 Subtype Avian Influenza Virus (AIV H9), and Infectious Bronchitis Virus (IBV).

[0119] 3. Using the genomic DNA samples obtained in step 1 and the eDNA samples obtained in step 2 as templates, semi-nested PCR was performed using the primer combination prepared in Example 1.

[0120] (1) Using each genomic DNA sample obtained in step 1 and each eDNA sample obtained in step 2 as a template, the first round of PCR amplification was performed using primer ChPV-F1 and primer ChPV-R:

[0121] Reaction system for the first round of PCR (25.0 μL): 12.5 μL of 2×PCR Mix, 1 μL of template (the content of DNA ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific primer combination for identifying a chicken parvovirus and application thereof. The primer combination provided by the invention consists of primers ChPV-F1, ChPV-F2 and ChPV-R, which are as shown by sequence tables 1, 2 and 3 respectively. The invention also protects application of the primer combination to the identification whether a to-be-detected virus is the chicken parvovirus or not and application of the primer combination to the identification whether a to-be-detected sample contains the chicken parvovirus or not. A method established by the invention can be used for quickly detecting the infection of ChPV, monitoring a noxious substance expelling condition after a chicken flock is inflected by the ChPV, and clinically monitoring the epidemiology of the ChPV, and has the characteristics of being simple, convenient and quick, being good in specificity and high in sensibility, and the like; the invention provides a novel method for the quick detection on the ChPV, which has an important meaning to the effective prevention and treatment on an epidemic disease caused by the virus.

Description

technical field [0001] The invention relates to a combination of specific primers for identifying chicken parvovirus and its application. Background technique [0002] Chicken parvovirus (Chincken parvovirus, ChPV) is one of the important pathogens that cause intestinal diseases in chickens. It can cause acute or chronic intestinal diseases characterized by diarrhea, mental depression, thermoregulation disorders, growth retardation, and increased feed consumption. , short stature syndrome, malnutrition syndrome. ChPV is ubiquitous in chicken flocks and mainly affects chicks, among which the infection rate of commercial broiler chickens is higher, followed by laying hens or breeder chickens. Since 2010, the disease has broken out in North America, Poland, Hungary, Croatia, Brazil, South Korea and other countries, causing large economic losses to the chicken industry. However, there is no report on the epidemiological investigation of chicken parvovirus in China . Therefore...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6848C12Q2531/113C12Q2549/119
Inventor 谢芝勋奉彬张艳芳黄娇玲王盛范晴黄莉谢丽基曾婷婷罗思思邓显文谢志勤刘加波
Owner GUANGXI VETERINARY RES INST