Specific primer combination for identifying chicken parvovirus and application thereof
A chicken parvovirus and primer combination technology, applied in the directions of microorganisms, recombinant DNA technology, microorganism-based methods, etc., can solve the problems of time-consuming, labor-intensive, sensitivity, low, etc., and achieve good specificity, high sensitivity, and good specificity. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0075] Embodiment 1, primer design
[0076] A large number of sequence analyzes and comparisons were carried out to obtain several primers for identifying chicken parvovirus. Preliminary experiments were performed on each primer to compare performances such as sensitivity and specificity, and finally a set of primer combinations for identifying chicken parvovirus was obtained.
[0077] The specific primer pair used to identify chicken parvovirus consists of the following three primers (5'→3'):
[0078] ChPV-F1 (Sequence 1 of the Sequence Listing): ATAACGATATCACTCAAGTTTCCAA;
[0079] ChPV-F2 (SEQ ID NO: 2 of the Sequence Listing): GCTGCAATCAGAGCAAGATG;
[0080] ChPV-R (SEQ ID NO: 3 of the SEQUENCE LISTING): GGGTTGGTTAAATGGCAAAG.
Embodiment 2
[0081] Embodiment 2, semi-nested PCR reaction condition optimization
[0082] 1. Extract the genomic DNA of chicken parvovirus.
[0083] 2. Take the genomic DNA obtained in step 1 as a template, and use the primer combination prepared in Example 1 to carry out semi-nested PCR.
[0084] (1) Using the genomic DNA obtained in step 1 as a template, use primer ChPV-F1 and primer ChPV-R to carry out the first round of PCR amplification:
[0085] Reaction system for the first round of PCR (25.0 μL): 12.5 μL of 2×PCR Mix, 1 μL of template (DNA content: 5.62 ng), 1 μL each of ChPV-F1 and ChPV-R, and finally use ddH 2 O to make up to 25.0 μL. In the first round of PCR reaction system, the concentrations of ChPV-F1 and ChPV-R were both 10 pmol / μL.
[0086] The reaction program of the first round of PCR: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 15 s, annealing for 30 s, a total of 30 cycles, and extension at 68°C for 10 min.
[0087] Set the annealing temperature a...
Embodiment 3
[0116] Embodiment 3, specificity
[0117] 1. Extract the genomic DNA of the sample to be tested. The samples to be tested are: chicken parvovirus (ChPV), Marek virus (MDV), and infectious laryngotracheitis virus (ILTV).
[0118] 2. Extract the total RNA of the sample to be tested and reverse transcribe it into cDNA. The samples to be tested are: Newcastle Disease Virus (NDV), H9 Subtype Avian Influenza Virus (AIV H9), and Infectious Bronchitis Virus (IBV).
[0119] 3. Using the genomic DNA samples obtained in step 1 and the eDNA samples obtained in step 2 as templates, semi-nested PCR was performed using the primer combination prepared in Example 1.
[0120] (1) Using each genomic DNA sample obtained in step 1 and each eDNA sample obtained in step 2 as a template, the first round of PCR amplification was performed using primer ChPV-F1 and primer ChPV-R:
[0121] Reaction system for the first round of PCR (25.0 μL): 12.5 μL of 2×PCR Mix, 1 μL of template (the content of DNA ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


