Method for cultivating low-cadmium-accumulation indica rice variety
A low-accumulation technology for indica rice varieties, applied in the field of rice biotechnology breeding, can solve the problems of affecting the agronomic traits of recipient varieties, changing the genetic background, and long breeding cycle, so as to achieve precise and controllable mutation sites, reduce the probability of off-target, and accelerate The effect of the breeding process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] A method for cultivating indica rice varieties with low cadmium accumulation of the present invention effectively improves the grain cadmium accumulation traits, and the steps are as follows:
[0044] 1) Cloning and sequencing the nucleotide sequence at positions 286-1251 after the translation initiation codon ATG of OsNramp5 of the indica rice variety Huazhan. The sequencing result is the sequence shown in SEQ ID NO.1:
[0045]GCAGCTAATCTTGGAGTGGTTACAGGGAGGCATCTGGCTGAGATCTGCAAGAGTGAGTACCCCAAGTTCGTCAAGATTTTCCTATGGCTGCTGGCAGAGTTGGCCGTCATCGCTGCAGATATCCCAGAAGTTATAGGGACGGCCTTTGCTTTCAACATATTGTTCCATATTCCGGTGTGGGTCGGCGTCCTCATCACCGGCACCAGCACTCTACTGCTTCTTGGCCTCCAAAAATACGGGGTGAGGAAGCTGGAGTTTCTGATATCGATGCTGGTGTTCGTGATGGCGGCGTGCTTCTTCGGGGAGCTGAGCATCGTGAAGCCGCCGGCGAAGGAGGTGATGAAGGGGCTCTTCATCCCCAGGCTCAACGGCGACGGCGCCACCGCCGACGCCATTGCCCTCCTCGGAGCTCTTGTCATGCCCCACAATCTGTTCTTGCATTCTGCCTTGGTGCTATCGAGGAAGACACCGGCATCAGTCAGAGGAATCAAGGACGGGTGCAGGTTCTTCCTGTACGAGAGCGGGTTCGCGCTGTTCGTGGCGCTGCTGATAA...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap