Method for cultivating low-cadmium-accumulation indica rice variety
A low-accumulation technology for indica rice varieties, applied in the field of rice biotechnology breeding, can solve the problems of affecting the agronomic traits of recipient varieties, changing the genetic background, and long breeding cycle, so as to achieve precise and controllable mutation sites, reduce the probability of off-target, and accelerate The effect of the breeding process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] A method for cultivating indica rice varieties with low cadmium accumulation of the present invention effectively improves the grain cadmium accumulation traits, and the steps are as follows:
[0044] 1) Cloning and sequencing the nucleotide sequence at positions 286-1251 after the translation initiation codon ATG of OsNramp5 of the indica rice variety Huazhan. The sequencing result is the sequence shown in SEQ ID NO.1:
[0045]GCAGCTAATCTTGGAGTGGTTACAGGGAGGCATCTGGCTGAGATCTGCAAGAGTGAGTACCCCAAGTTCGTCAAGATTTTCCTATGGCTGCTGGCAGAGTTGGCCGTCATCGCTGCAGATATCCCAGAAGTTATAGGGACGGCCTTTGCTTTCAACATATTGTTCCATATTCCGGTGTGGGTCGGCGTCCTCATCACCGGCACCAGCACTCTACTGCTTCTTGGCCTCCAAAAATACGGGGTGAGGAAGCTGGAGTTTCTGATATCGATGCTGGTGTTCGTGATGGCGGCGTGCTTCTTCGGGGAGCTGAGCATCGTGAAGCCGCCGGCGAAGGAGGTGATGAAGGGGCTCTTCATCCCCAGGCTCAACGGCGACGGCGCCACCGCCGACGCCATTGCCCTCCTCGGAGCTCTTGTCATGCCCCACAATCTGTTCTTGCATTCTGCCTTGGTGCTATCGAGGAAGACACCGGCATCAGTCAGAGGAATCAAGGACGGGTGCAGGTTCTTCCTGTACGAGAGCGGGTTCGCGCTGTTCGTGGCGCTGCTGATAA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


