Method for cultivating low-cadmium-accumulation indica rice variety

A low-accumulation technology for indica rice varieties, applied in the field of rice biotechnology breeding, can solve the problems of affecting the agronomic traits of recipient varieties, changing the genetic background, and long breeding cycle, so as to achieve precise and controllable mutation sites, reduce the probability of off-target, and accelerate The effect of the breeding process

Active Publication Date: 2017-03-29
HUNAN HYBRID RICE RES CENT
View PDF1 Cites 54 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The traditional method of improving the grain cadmium content of varieties is to use low-cadmium materials to hybridize and backcross with acceptor materials, combined with observation of offspring agronomic traits and multi-generation screening of cadmium content identification. This breeding method has a large workload and a long breeding cycle. How many generations of backcrossing will infiltrate other genes linked to the target gene, changing the genetic background and affecting the agronomic traits of the recipient variety

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for cultivating low-cadmium-accumulation indica rice variety
  • Method for cultivating low-cadmium-accumulation indica rice variety
  • Method for cultivating low-cadmium-accumulation indica rice variety

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] A method for cultivating indica rice varieties with low cadmium accumulation of the present invention effectively improves the grain cadmium accumulation traits, and the steps are as follows:

[0044] 1) Cloning and sequencing the nucleotide sequence at positions 286-1251 after the translation initiation codon ATG of OsNramp5 of the indica rice variety Huazhan. The sequencing result is the sequence shown in SEQ ID NO.1:

[0045]GCAGCTAATCTTGGAGTGGTTACAGGGAGGCATCTGGCTGAGATCTGCAAGAGTGAGTACCCCAAGTTCGTCAAGATTTTCCTATGGCTGCTGGCAGAGTTGGCCGTCATCGCTGCAGATATCCCAGAAGTTATAGGGACGGCCTTTGCTTTCAACATATTGTTCCATATTCCGGTGTGGGTCGGCGTCCTCATCACCGGCACCAGCACTCTACTGCTTCTTGGCCTCCAAAAATACGGGGTGAGGAAGCTGGAGTTTCTGATATCGATGCTGGTGTTCGTGATGGCGGCGTGCTTCTTCGGGGAGCTGAGCATCGTGAAGCCGCCGGCGAAGGAGGTGATGAAGGGGCTCTTCATCCCCAGGCTCAACGGCGACGGCGCCACCGCCGACGCCATTGCCCTCCTCGGAGCTCTTGTCATGCCCCACAATCTGTTCTTGCATTCTGCCTTGGTGCTATCGAGGAAGACACCGGCATCAGTCAGAGGAATCAAGGACGGGTGCAGGTTCTTCCTGTACGAGAGCGGGTTCGCGCTGTTCGTGGCGCTGCTGATAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for cultivating a low-cadmium-accumulation indica rice variety. The method includes the steps of cloning part of the CDS sequence of OsNramp5 of an indica rice acceptor material; using a CRISPR / Cas9 system to select a target sequence according to an exon sequence; building pCRISPR / Cas9 recombinant vectors; leading the pCRISPR / Cas9 recombinant vectors into rice calluses to obtain transgene seedlings; screening transgene positive plants; obtaining mutant plants; and conducting seed propagation of the mutant plants, and separating afunction mutants containing no transgenic ingredients from plant progenies. By means of the method, the cadmium absorption major gene OsNramp5 of indica rice is directionally knocked out through the CRISPR / Cas9 technology, and the indica rice material containing no transgenic ingredients, having no significantly variant comprehensive agronomic characters and achieving a low cadmium content in rice is directionally cultivated. The method has the advantages that targeting is efficient, the breeding period is short, cost is low and practicality is high.

Description

technical field [0001] The invention relates to the field of rice biotechnology breeding, in particular to a method for cultivating indica rice varieties with low cadmium accumulation. Background technique [0002] In the past 20 years, with the development of mining and smelting in my country, the discharge of industrial "three wastes", poor treatment of urban garbage and sewage irrigation, etc., have caused the problem of heavy metal pollution in soil to become increasingly prominent. Rice is the main food crop in my country, and it is also one of the crops that are relatively easy to accumulate cadmium (Cdmium, Cd). After cadmium is absorbed into rice along with water and nutrients, it not only affects the growth and development of rice, but also endangers human health through the enrichment of food chain. In some places in China, people’s kidney function damage and bone pain have been caused by eating high-cadmium-contaminated rice. As early as the middle of the 20th ce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82A01H5/00
CPCC07K14/415C12N15/8221C12N15/8261C12N2800/80C12N2810/10
Inventor唐丽赵炳然吕启明韶也李曜魁毛毕刚
OwnerHUNAN HYBRID RICE RES CENT