Unlock instant, AI-driven research and patent intelligence for your innovation.

Antibacterial lipopeptide bacaucin derivatives and their application in inhibiting bacterial infection

A derivative and bacterial technology, applied in the preservation, antibacterial, and application of food ingredients as antimicrobials, can solve problems such as poor thermal or acid-base stability, poor protease stability, and limited antibacterial properties.

Active Publication Date: 2020-04-21
CHINA AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the antibacterial properties of most small molecular polypeptides are limited to in vitro antibacterial activity, poor stability to heat or acid and alkali, and poor stability to proteases, which greatly limits their activity in vivo and in the field of disease treatment. Applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antibacterial lipopeptide bacaucin derivatives and their application in inhibiting bacterial infection
  • Antibacterial lipopeptide bacaucin derivatives and their application in inhibiting bacterial infection
  • Antibacterial lipopeptide bacaucin derivatives and their application in inhibiting bacterial infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0102] Example 1. Preparation of antibacterial lipopeptide bacaucin and its antibacterial activity

[0103] The present invention isolates a strain of bacteria from soil, uses primer pairs AGAGTTTGATCCTGGCTCAG (sequence 1) and ACGGCTACCTTGTTACGACTT (sequence 2) designed at both ends of the 16S rRNA to carry out PCR amplification of the 16S rRNA of the strain, and the 16S of the amplified product The rRNA sequence is shown in sequence 3 in the sequence table, and the sequence analysis result of the 16S rRNA of this strain is shown as figure 1 As shown, the sequence of the 16S rRNA was found by sequence comparison to indicate that the strain was Bacillus subtilis (Bacillus subtilis), and the strain was named Bacillus subtilis (CAU21).

[0104] Bacillus subtilis (CAU21), the cells are rod-shaped, with a diameter of 0.6μm~1.0μm and a length of 1.5μm~2.0μm. The spores are mesophytic, oval, cysts are not enlarged, and Gram reaction is positive. The colony formed by culturing on a mangan...

Embodiment 2

[0138] Example 2. Preparation of antibacterial lipopeptide bacaucin derivative and its antibacterial activity

[0139] The antibacterial lipopeptide bacaucin of Example 1 was optimized to obtain a variety of bacaucin derivatives (bacaucinDerivatives), namely Bacaucin-1~Bacaucin-16, Bacaucin-1 is a small molecule polypeptide, and other Bacaucin derivatives Bacaucin-2~Bacaucin-16 All are polypeptides, among which Bacaucin-8 is a cyclic polypeptide, the 5th position of Bacaucin-10 is an ornithine (Orn) residue, the N-terminus of Bacaucin-12 is modified by Ac, and the amino acid sequence of Bacaucin-1~Bacaucin-16 They are sequences 4-19 in the sequence table, and the specific information is as follows Figure 4 As shown, 1 to 16 respectively represent Bacaucin-1 to Bacaucin-16.

[0140] Bacaucin-1~Bacaucin-16 were synthesized by Shanghai Jier Biochemical Co., Ltd. After synthesis, the purity and molecular weight of these bacaucin derivatives were determined by high performance liquid c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses antimicrobial lipopeptide bacaucin derivatives and application thereof in bacterial infection inhibition. The antimicrobial lipopeptide bacaucin derivatives disclosed by the invention are polypeptides shown as SEQ ID No. 4 and SEQ ID No. 9-18 or derivatives thereof. The experiment proves that the bacaucin derivatives disclosed by the invention have effects of inhibiting bacteria, particularly bacaucin-1 has a specific effect on inhibiting staphylococcus aureus, and the minimum inhibitory concentration is 4mu g / mL; and moreover, the derivatives do not have any cytotoxic effect on Vero, Hep-2 and A549, are not hemolytic, have excellent histocompatibility and do not have any toxic effect on zebrafish embryos. The bacaucin derivatives have effects on inhibiting Gram positive bacteria and Gram negative bacteria and can be used for inhibiting bacteria.

Description

Technical field [0001] The invention relates to an antibacterial lipopeptide bacaucin derivative and its application in inhibiting bacterial infection in the field of biotechnology. Background technique [0002] The large-scale use of antibiotics began in the 1940s and played a decisive role in the treatment of bacterial infections, saving countless lives. Because low-dose antibiotics can promote the growth of animals, some antibiotics are added to feed as antibacterial growth promoters (AGP) and are widely used worldwide. In the modern aquaculture industry characterized by large-scale and intensification, antibiotics play an irreplaceable role in the prevention and control of animal diseases, ensuring sufficient meat, eggs, milk and other food supplies. Especially when the management level of the aquaculture industry in my country is low and the degree of intensification is not high, antibiotics have played an extremely important role in reducing animal disease, reducing mortal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K7/06C12N15/11A61K38/08A61P31/04A23L3/3526
CPCA23B4/20A23L3/3526A23V2002/00A61K38/00C07K7/06A23V2200/10A23V2250/55
Inventor 朱奎丁双阳沈建忠刘源崔一芳刘晓晔夏曦
Owner CHINA AGRI UNIV