Antibacterial lipopeptide bacaucin derivatives and their application in inhibiting bacterial infection
A derivative and bacterial technology, applied in the preservation, antibacterial, and application of food ingredients as antimicrobials, can solve problems such as poor thermal or acid-base stability, poor protease stability, and limited antibacterial properties.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0102] Example 1. Preparation of antibacterial lipopeptide bacaucin and its antibacterial activity
[0103] The present invention isolates a strain of bacteria from soil, uses primer pairs AGAGTTTGATCCTGGCTCAG (sequence 1) and ACGGCTACCTTGTTACGACTT (sequence 2) designed at both ends of the 16S rRNA to carry out PCR amplification of the 16S rRNA of the strain, and the 16S of the amplified product The rRNA sequence is shown in sequence 3 in the sequence table, and the sequence analysis result of the 16S rRNA of this strain is shown as figure 1 As shown, the sequence of the 16S rRNA was found by sequence comparison to indicate that the strain was Bacillus subtilis (Bacillus subtilis), and the strain was named Bacillus subtilis (CAU21).
[0104] Bacillus subtilis (CAU21), the cells are rod-shaped, with a diameter of 0.6μm~1.0μm and a length of 1.5μm~2.0μm. The spores are mesophytic, oval, cysts are not enlarged, and Gram reaction is positive. The colony formed by culturing on a mangan...
Embodiment 2
[0138] Example 2. Preparation of antibacterial lipopeptide bacaucin derivative and its antibacterial activity
[0139] The antibacterial lipopeptide bacaucin of Example 1 was optimized to obtain a variety of bacaucin derivatives (bacaucinDerivatives), namely Bacaucin-1~Bacaucin-16, Bacaucin-1 is a small molecule polypeptide, and other Bacaucin derivatives Bacaucin-2~Bacaucin-16 All are polypeptides, among which Bacaucin-8 is a cyclic polypeptide, the 5th position of Bacaucin-10 is an ornithine (Orn) residue, the N-terminus of Bacaucin-12 is modified by Ac, and the amino acid sequence of Bacaucin-1~Bacaucin-16 They are sequences 4-19 in the sequence table, and the specific information is as follows Figure 4 As shown, 1 to 16 respectively represent Bacaucin-1 to Bacaucin-16.
[0140] Bacaucin-1~Bacaucin-16 were synthesized by Shanghai Jier Biochemical Co., Ltd. After synthesis, the purity and molecular weight of these bacaucin derivatives were determined by high performance liquid c...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


