Rs8099917 genotyping dual-color fluorescence PCR rapid detection kit
A detection kit and two-color fluorescence technology, which is applied in the determination/testing of microorganisms, DNA/RNA fragments, biochemical equipment and methods, etc., can solve the problems of difficult general hospitals, expensive equipment, poor specificity, etc., and achieve high sensitivity High, short detection time, easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] This embodiment provides a rapid detection kit for rs8099917 site genotyping two-color fluorescent PCR
[0025] 1. Kit composition and preparation
[0026] 1) Primers and probe sets
[0027] Primer probe set based on rs8099917 site
[0028] Forward primer F, the nucleotide sequence of which is shown in SEQ ID NO.1;
[0029] 5' TGTTTTCCTTTCTGTGAGCA 3';
[0030] Reverse primer R, the nucleotide sequence of which is shown in SEQ ID NO.2;
[0031] 5'GTAAGACATAAAAAGCCAGCTA 3';
[0032] T fluorescent probe S1, the nucleotide sequence of which is shown in SEQ ID NO.3;
[0033] 5'FAM-TGAGCAATTTCACCC-NFQ 3'-MGB, FAM probe;
[0034] G fluorescent probe S2, the nucleotide sequence of which is shown in SEQ ID NO.4;
[0035] 5'VIC-TGTGAGCAATGTCAC-NFQ 3'-MGB, VIC probe
[0036] The above primers and probes were all synthesized artificially by Shanghai Sangon Biotechnology Co., Ltd.
[0037] 2) DNA extraction solution
[0038] The DNA extraction solution can use a commercial...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



