Rs8099917 genotyping dual-color fluorescence PCR rapid detection kit

A detection kit and two-color fluorescence technology, which is applied in the determination/testing of microorganisms, DNA/RNA fragments, biochemical equipment and methods, etc., can solve the problems of difficult general hospitals, expensive equipment, poor specificity, etc., and achieve high sensitivity High, short detection time, easy operation

Inactive Publication Date: 2017-05-24
WUHAN UNIV
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there are many methods for identifying the polymorphism of the rs8099917 locus gene, mainly using methods such as gene sequencing, gene chip, high-resolution melting curve (HRM) and

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rs8099917 genotyping dual-color fluorescence PCR rapid detection kit
  • Rs8099917 genotyping dual-color fluorescence PCR rapid detection kit
  • Rs8099917 genotyping dual-color fluorescence PCR rapid detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] This embodiment provides a rapid detection kit for rs8099917 site genotyping two-color fluorescent PCR

[0025] 1. Kit composition and preparation

[0026] 1) Primers and probe sets

[0027] Primer probe set based on rs8099917 site

[0028] Forward primer F, the nucleotide sequence of which is shown in SEQ ID NO.1;

[0029] 5' TGTTTTCCTTTCTGTGAGCA 3';

[0030] Reverse primer R, the nucleotide sequence of which is shown in SEQ ID NO.2;

[0031] 5'GTAAGACATAAAAAGCCAGCTA 3';

[0032] T fluorescent probe S1, the nucleotide sequence of which is shown in SEQ ID NO.3;

[0033] 5'FAM-TGAGCAATTTCACCC-NFQ 3'-MGB, FAM probe;

[0034] G fluorescent probe S2, the nucleotide sequence of which is shown in SEQ ID NO.4;

[0035] 5'VIC-TGTGAGCAATGTCAC-NFQ 3'-MGB, VIC probe

[0036] The above primers and probes were all synthesized artificially by Shanghai Sangon Biotechnology Co., Ltd.

[0037] 2) DNA extraction solution

[0038] The DNA extraction solution can use a commercial...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an rs8099917 locus gene based genotyping dual-color fluorescence PCR rapid detection kit. Primers and TaqMan-MGB probes are redesigned to optimize the reaction system, a two-component hot start DNA polymerase composes an enzyme activity automatic regulating system, ROX Reference Dye can eliminate a signal background and correct the fluorescence signal error generated between holes, thus realizing accurate, high amplification efficiency, high sensitivity, good specificity, good repeatability, simple operation and short-time detection. Therefore, the technology can achieve clinical application and promotion.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a rapid detection kit for two-color fluorescence PCR based on rs8099917 site genotyping. Background technique [0002] Hepatitis C is a viral hepatitis caused by hepatitis C virus (HCV) infection, which is mainly transmitted through blood transfusion, acupuncture and drug abuse. Existing studies have shown that the rs8099917 polymorphism of the human IL-28B gene is correlated with the efficacy of antiviral therapy. [0003] At present, there are many methods for identifying the polymorphism of the rs8099917 locus gene, mainly using methods such as gene sequencing, gene chip, high-resolution melting curve (HRM) and enzyme digestion, but most of the operations are complicated, time-consuming, and require The equipment is expensive and the specificity is poor, so it is difficult to carry out in ordinary hospitals. Contents of the invention [0004] The purpose of the present inventi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6883C12Q1/686C12Q2600/106C12Q2600/156C12Q2563/107C12Q2521/101C12Q2531/113
Inventor 王业富赵友云孙莉军郑毅
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap