High-sensitivity gene mutation detection method and kit used in same

A detection kit and high-sensitivity technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of long detection cycle, inaccurate detection results, low sensitivity, etc., and achieve low detection cost and convenient design Primer, high sensitivity effect

Inactive Publication Date: 2017-05-31
HANGZHOU JINXI BIOLOGICAL TECH
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The technical problem to be solved by the present invention is to provide a high-sensitivity gene point mutation detection method and the kit used, aiming to solve the problems of long detection cycle, low sensitivity and inaccurate detection results in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-sensitivity gene mutation detection method and kit used in same
  • High-sensitivity gene mutation detection method and kit used in same
  • High-sensitivity gene mutation detection method and kit used in same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] 1), the design method of LNA-modified ARMS-like primers:

[0067] The sequence (part) of the wild-type / mutant type MINA plasmid is as follows:

[0068] Mutation type (C / T)

[0069] aaagattttgatcagaaaagggcaacgattcagtttcaccaacctcagagatttaaggatgagctttggaggatccaggagaagctggaatgttactttggctccttggttggctcgaatgtgtacataactcccgcaggatctcagggcctgccgccccattatgatgatgtcgaggttttcatcctgcagctggagggagagaaacactggcgcctctaccaccccactgtgcccctggcacgagagtacagcgtggaggccgaggaaaggatcggcaggccggtgcatgagtttatgctgaagccgggtgatttgttgtactttcccagaggaaccatt C(T) atcaagcggacactcctgcggggctggcccactcgactcacgtgaccatcagcacctaccagaacaattcatggggagatttccttttggataccatctcggggcttgtatttgatactgcaaaggaagacgtggagttacggaccggcataccccggcagctgctcctgcaggtggaatccacaactgttgctacaagacgattaagtggcttcctgaggacacttgcagaccggctggagggcaccaaagaactgctttcctcagacatgaagaaggattttattatgcacagactccccccttactctgc。

[0070] The design rule of the LNA-modified ARMS-like primer is as follows: a base at the 3' end is modified to lock nucleic acid, the pr...

Embodiment 2

[0099] Example 2. Detection of mutations in exon 15 of the B-raf gene

[0100] The wild-type / mutant B-raf sequence (part) is as follows:

[0101] Mutation type (T / A)

[0102] aatcattgttttagacatacttattgactctaagaggaaagatgaagtactatgttttaaagaatattatattacagaattatagaaattagatctcttacctaaactcttcataatgcttgctctgataggaaaatgagatctactgttttcctttacttactacacctcagatatatttcttcatgaagacctcacagtaaaaataggtgattttggtctagctacagT(A)gaaatctcgatggagtgggtcccatcagtttgaacagttgtctggatccattttgtggatggtaagaattgaggctatttttccactgattaaatttttggccctgagatgctgctgagttactagaaagtcattgaaggtctcaactatagtattttcatagttcccagt。

[0103] Therefore, the designed LNA-modified ARMS-like primer is: SEQ ID NO: 4, and another conventional primer is SEQ ID NO: 5.

[0104] Numbering Primer sequence (5'-3') SEQ ID NO:4 GGTGATTTTGGTCTAGCTACAGA SEQ ID NO:5 CTGATGGGACCCACTCCATCGA

[0105] The rest are equal to Example 1.

[0106] The result is as Figure 6 shown, according to Figure 6, we know that the Ct v...

Embodiment 3

[0107] Example 3. Detection of mutations in the 12th codon of exon 2 of the K-ras gene

[0108] The wild-type / mutant K-ras sequence (part) is as follows:

[0109] Mutation type (G / A)

[0110] attgaattttgtaaggtattttgaaataatttttcatataaaggtgagtttgtattaaaaggtactggtggagtatttgatagtgtattaaccttatgtgtgacatgttctaatatagtcacattttcattatttttattataaggcctgctgaaaatgactgaatataaacttgtggtagttggagctgG(A)tggcgtaggcaagagtgccttgacgatacagctaattcagaatcattttgtggacgaatatgatccaacaatagaggtaaatcttgttttaatatgcatattactggtgcaggaccattctttgatacagataaaggtttctctgaccattttcatgagtacttattac。

[0111] Therefore, the designed LNA-modified ARMS-like primer is: SEQ ID NO:6, and another conventional primer is SEQ ID NO:7.

[0112] Numbering Primer sequence (5'-3') SEQ ID NO:6 ACTTGTGGTAGTTGGAGCTGA SEQ ID NO:7 TCGTCAAGGCACTCTTGCCTACG

[0113] The rest are equal to Example 1.

[0114] The result is as Figure 7 shown, according to Figure 7 , we know that the Ct value of the mutant sample i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-sensitivity gene mutation detection kit which comprises a PCR buffer solution, DNA polymerase without exonuclease activity, an LNA modified ARMS-like primer, a conventional primer, dNTP mixed liquid, nucleic acid dye and reference dye. The end 3' of the LNA modified ARMS-like primer is nucleic acid analogue; methylene is introduced to the sites of 2' oxygen atom and 4' carbon atom of the carbon ring of the nucleic acid analogue to form a lock structure, so that the LNA remarkably enhances the oligonucleotide identifying capability. The invention also provides a high-sensitivity gene mutation detection method adopting the kit, wherein if the result of PCR reaction has an amplification curve, the to-be-detected sample is a mutant sample; otherwise, if the result of PCR reaction does not have an amplification curve, the to-be-detected sample is a wild sample.

Description

technical field [0001] The invention belongs to the technical field of clinical molecular diagnosis, and in particular relates to a point mutation detection method. Background technique [0002] Single nucleotide polymorphisms (SNP for short) are the most common type of genetic variation in individuals, accounting for more than 90% of all known polymorphisms. SNP research has become the most popular topic now, and it can be used for fine mapping of trait genes, molecular assisted breeding, and identification of seed resources. In the medical field, the relationship between SNP and cancer susceptibility and individualized treatment has attracted more and more attention. [0003] It is well known that part of the risk of disease is genetic, and SNPs may be associated with an individual's risk of developing cancer. In recent years, studies on the relationship between SNPs and susceptibility to common cancers have emerged in an endless stream. For example: BRCA1 and BRCA2 gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q2521/101C12Q2525/117C12Q2563/107
Inventor朱成钢谢君王英杰
OwnerHANGZHOU JINXI BIOLOGICAL TECH