Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bemisia tabaci MED (Mediterranean) cryptic species laccase LAC1 (laccase 1) and gene and application thereof

A Bemisia tabaci and gene technology, applied in the field of genetic engineering, can solve problems such as protein sequence differences, gene function differences, etc.

Inactive Publication Date: 2017-06-23
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Because there are many cryptic species of Bemisia tabaci, there are differences in gene sequences among different cryptic species, which leads to differences in protein sequences, so their gene functions may also be different

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bemisia tabaci MED (Mediterranean) cryptic species laccase LAC1 (laccase 1) and gene and application thereof
  • Bemisia tabaci MED (Mediterranean) cryptic species laccase LAC1 (laccase 1) and gene and application thereof
  • Bemisia tabaci MED (Mediterranean) cryptic species laccase LAC1 (laccase 1) and gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1: Cloning of the full-length cDNA sequence of the Bemisia tabaci MED BtQLAC1 gene

[0021] 200 adults of Bemisia tabaci MED cryptic species were collected, RNA was extracted and stored in an ultra-low temperature refrigerator for future use. The cDNA was synthesized using the reverse transcription kit (Super Script First-Strand Synthesis System) of Transgen Company. Design primers MED BtQLAC1-F and MEDBtQLAC1-R:

[0022] BtQLAC-F:5'-CGCCTCTAGCGATTTTCAAC-3'

[0023] BtQLAC-R:5'-CGATGACTGGGTTGTTGTTG-3'

[0024] The middle fragment of MED BtQLAC1 gene of Bemisia tabaci MED cryptic species was amplified by PCR using cDNA as template. According to the middle fragment sequence of the obtained B. tabaci MED BtQLAC1 gene, 5'RACE and 3'RACE specific primers were designed to amplify the 5' and 3' end sequences of the MEDBtQLAC1 gene by PCR:

[0025] GSP1:5'-GCTGCTGTTGAGGGTTGACTTGTGG-3'

[0026] GSP2:5'-TCGAACCGGAAGAAGCAACCTCACT-3'

[0027] NGSP1:5'-F AGTTGCAGGAGGCA...

Embodiment 2

[0030] Example 2 Functional verification of MED BtQLAC1 gene

[0031] Select the more active adult individuals of two kinds of whiteflies raised with tomatoes as the source of test insects, randomly take 200, put them into a transparent glass tube (3 cm in diameter, 8 cm in height) at both ends, and cover the upper end of the glass tube with a double-layer Parafilm film Cover and carry out artificial rearing, and add 200 μL of feeding solution between the two layers of Parafilm, and the feeding solution is a mixture of 10% sucrose plus 10 mM MES dissolved in distilled water. In addition, the feeding solution without whitefly feeding was used as a control.

[0032] After 24 hours of feeding by whiteflies, use a disposable syringe to recover the feeding solution containing whitefly saliva and the feeding solution that has not been fed by whitefly. During the suction process, care should be taken to prevent the bottom membrane from breaking. The reaction was carried out at 28°C....

Embodiment 3

[0037] Example 3: Effect of dsRNA treatment of MED BtQLAC1 gene on survival rate of Bemisia tabaci MED on tomato

[0038] 1. Preparation of dsRNA template:

[0039] Primer sequence after adding T7 promoter (underlined sequence):

[0040] T7+MED BtQLAC1-F:

[0041] TAATACGACTCACTATAGGG ACTCATTTCTGGCACTCGCA;

[0042] T7+MED BtQLAC1-F:

[0043] TAATACGACTCACTATAGGG TCTTCCGGTTCGATGTCACC.

[0044] Total RNA extraction and cDNA synthesis: the same as in Example 1.

[0045] Perform PCR amplification with T7 primers, and then purify the product, and the purified PCR product is the template for synthesizing dsRNA.

[0046] 2. Synthesis and purification of dsRNA

[0047] use The RNAi Kit kit synthesizes and purifies dsRNA.

[0048] 3. dsRNA feeding

[0049]Take about 200 adults of the newly emerged whitefly MED cryptic species and put them into a glass tube with transparent ends. The upper end of the glass tube is covered with two layers of Parafilm membranes, and 20% sucr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene engineering, in particular to a bemisia tabaci MED (Mediterranean) cryptic species laccase LAC1 (laccase 1) and a gene and application thereof. The amino acid sequence of the laccase is shown in SEQ ID NO:1. The bemisia tabaci MED cryptic species laccase LAC1 is cloned to the cDNA of an MED BtQLAC1 gene from bemisia tabaci MED cryptic species, and an MED BtQLAC1 gene dsRNA is fed to cause the feeding death rate of bemisia tabaci MED cryptic species imagoes on a tomato plant to be obviously increased. The experiment result of the bemisia tabaci MED cryptic species laccase LAC1 makes clear the function of the MED BtQLAC1 gene in feeding of the bemisia tabaci MED, and a basis is expected to provide for further researching an anti-defense mechanism in the feeding process of the bemisia tabaci MED and controlling bemisia tabaci harm through plant adaptability in the future.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to the Bemisia tabaci MED cryptic laccase LAC1 and its gene and application. Background technique [0002] During the co-evolution of plants and insects, plants have evolved a variety of defense mechanisms to protect themselves from insects, and herbivorous insects have also developed sophisticated behavioral and physiological mechanisms to adapt to existing host plants or develop new ones. host plant. In response to plant defenses, herbivorous insects have also evolved a variety of behavioral and physiological mechanisms to cope with plant defenses, so that they can successfully survive on some specific plants or adapt to a variety of different host plants. [0003] Laccase (EC 1.10.3.2) is widely distributed in fungal secretions, higher plants, insects and a small number of bacteria. It is a polyphenol oxidase with p-hydroquinone dioxygen redox activity and belongs to the blue ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/53A01N57/16A01P7/04
CPCA01N57/16C12N9/0061C12Y110/03002
Inventor 郭建洋杨春红万方浩
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com