Unlock instant, AI-driven research and patent intelligence for your innovation.

Transgenic algae strain with high yield of nano polyphosphate body and preparation method thereof

A technology of polyphosphoric acid and polyphosphoric acid, which is applied in the field of genetic engineering, can solve the problems of adverse effects on microalgae growth kinetics, low quality of expression products, and difficulty in inducing expression, so as to achieve green production methods and research and utilization value High, simple and convenient method

Active Publication Date: 2020-03-17
OCEAN UNIV OF CHINA
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although the transgenic method of microalgae is relatively mature, it still faces many problems and challenges such as low success rate, difficulty in inducing expression, low expression efficiency, and low quality of expression products. At the same time, the expression of some foreign genes will affect the growth of microalgae. Kinetics come with some downsides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenic algae strain with high yield of nano polyphosphate body and preparation method thereof
  • Transgenic algae strain with high yield of nano polyphosphate body and preparation method thereof
  • Transgenic algae strain with high yield of nano polyphosphate body and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] 1) Acquisition of the target gene

[0032] Specific primer design:

[0033] ppk Front primer: CCCAAGCTTGAAGGAGATAAAAAGTATATGTCCTCTGCG

[0034] ppkBack primer: CGGGGTACCCCTAATCCAAGCTGTCCTGGAG

[0035] Hind III and Kpn I restriction sites were added to the front and back primers respectively, and the RBS sequence of the GAAGGAG sequence was added to the front primer.

[0036] PCR conditions: 50 μL reaction system, 94°C for 5 min, (94°C for 30 s, 60°C for 40 s, 1 min and 72°C) for 30 cycles; 72°C for 10 min.

[0037] The target gene was purified and cloned by conventional methods for later use.

[0038] 2) Construction of the recombinant pSyn_1 plasmid: the pSyn_1 plasmid and the target gene were digested with Hind III and Kpn I, and the digested products were purified and ligated. 100 ng of the pSyn_1 plasmid and ppk 500 ng of the gene was ligated with T4 DNA ligase at 16°C for 3 h. The ligated plasmid was cloned by conventional methods, digested with restriction e...

Embodiment 2

[0042] 1) Acquisition of the target gene

[0043] Specific primer design:

[0044] ppk Front primer: CCCAAGCTTGAAGGAGATAAAAAGTATATGTCCTCTGCG

[0045] ppk Back primer: CGGGGTACCCTAATCCAAGCTGTCCTGGAG

[0046] Hind III and Kpn I restriction sites were added to the front and back primers respectively, and the RBS sequence of the GAAGGAG sequence was added to the front primer.

[0047] PCR conditions: 50 μL reaction system, 94°C for 5 min, (94°C for 30 s, 60°C for 40 s, 1 min and 72°C) for 30 cycles; 72°C for 10 min.

[0048] The target gene was purified and cloned by conventional methods for later use.

[0049] 2) Construction of the recombinant pSyn_1 plasmid: the pSyn_1 plasmid and the target gene were digested with Hind III and Kpn I, and the digested products were purified and ligated. 100 ng of the pSyn_1 plasmid and ppk 1 μg of gene was ligated with T4 DNA ligase at 16°C for 1 h. The ligated plasmid was cloned by conventional methods, digested with restriction enzyme...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a transgenic algal strain for highly producing nano-polyphosphoric acid and a preparation method of same. The transgenic algal strain is a transgenic microalgae prepared by introducing a recombinant pSyn-1 plasmid, which contains a homologous ppk gene, on the basis of synechococcus 7002, and performing screening and identification. The capability of producing the nano-polyphosphoric acid with the transgenic algal strain is improved than that with a wild strain by 90-150%, wherein the method of inducing and accumulating the polyphosphoric acid of the algal strain is carried out with induction by 0.5-5 [mu]M of nickel ions. The algal strain has good operability and genetic stability, wherein an exogenous gene can be expressed durably for more than 1 year. The nano-polyphosphoric acid produced with the algal strain is in nano scale and is 100 nm in size range. The nano-polyphosphoric acid has excellent nanometer form during the extraction process.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a transgenic algae strain with high yield of nanometer polyphosphoric acid body. Background technique [0002] Mineral nutritional deficiencies, especially calcium, iron, and zinc deficiencies, are one of the most serious public health problems in the world today. Higher than vitamin nutritional deficiencies. Negative health effects of mineral malnutrition are established early in life and can lead to stunted growth, poor cognition, lethargy, difficulty concentrating and greater susceptibility to major infectious diseases, reducing an individual's educational attainment. ability, physical capacity, and life expectancy. Mineral nutrition intervention is particularly important for people to get rid of the "poverty trap" of mineral nutrition deficiency and improve people's health. [0003] Biomineralized nanostructures have unique application advantages in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/31C12N15/74C12P3/00C12R1/01
CPCC07K14/195C12N15/74C12P3/00
Inventor 曾名湧高风正吴浩浩黄敏冯广鑫
Owner OCEAN UNIV OF CHINA