Check patentability & draft patents in minutes with Patsnap Eureka AI!

Cas9 nuclease delta F916 and application thereof

A technology of nuclease and nuclease activity, which is applied in the direction of application, hydrolase, and the introduction of foreign genetic material using vectors, etc., to achieve the effect of precise editing

Active Publication Date: 2017-07-18
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the editing of DNA fragments can be realized through the CRISPR / Cas9 system, but for the in-depth study of the precise function of specific DNA segments, the Cas9 nuclease that can effectively realize the precise genetic editing of DNA fragments has yet to be discovered

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cas9 nuclease delta F916 and application thereof
  • Cas9 nuclease delta F916 and application thereof
  • Cas9 nuclease delta F916 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Example 1 Study on the connection of adapters for DNA fragment editing and discovery of a new mechanism for Cas9 cutting

[0078] For the HS51 site, construct the sgRNAs plasmid targeting the HS51 site:

[0079] (1) Purchase primers

[0080] Purchase forward and reverse deoxy oligonucleotides with 5' hanging ends "ACCG" and "AAAC" that can be complementary paired for the HS51 site and the sgRNAs targeting sequence respectively from Shanghai Sunny Biotechnology Co., Ltd.;

[0081] Targeting sequences of sgRNAs targeting the above HS51 site:

[0082] HS51 RE1 sgRNA1: GCCACACATCCAAGGCTGAC (SEQ ID NO.1)

[0083] HS51 RE1 sgRNA2: GAGATTTGGGGCGTCAGGAAG (SEQ ID NO.2)

[0084] (2) Obtain complementary paired double-stranded DNA with hanging ends

[0085] 1) use ddH 2 O Dissolve deoxyoligonucleotides to 100 μM and dilute to 20 μM;

[0086] 2) Add positive and negative deoxy oligonucleotides to the following reaction system:

[0087]

[0088] Reaction conditions: 95°C w...

Embodiment 2

[0156] Example 2 Mutation of SpCas9 to obtain a specific Cas9 with a changed cutting method to achieve precise DNA fragment editing

[0157] 1. Construction of Cas9 mutants

[0158] 1) Use NEB Mutagenesis Kit (Q5Site-Directed Mutagenesis Kit, #E0554S) to construct Cas9 mutants, first perform PCR amplification, and the reaction is as follows:

[0159]

[0160]

[0161] 2) KLD (Kinase, Ligase&DpnI) treatment, the reaction is as follows:

[0162]

[0163] Reaction conditions: 10 minutes at room temperature

[0164] 3) All the reaction products in 2) were used for the transformation of competent bacteria Stbl3 (50 μl), and cultured on LB plates containing ampicillin antibiotic (Amp, 100 mg / L) overnight at 37° C. Single clones were picked, plasmids were extracted and sent for sequencing.

[0165] The amino acid sequence of SpCas9 (Cas9WT) is shown in SEQ ID NO.7, specifically:

[0166]

[0167]

[0168] The coding nucleotide sequence of SpCas9 (Cas9WT) is shown i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology and particularly relates to Cas9 nuclease and application. The Cas9 nuclease (Cas9-delta F916) disclosed by the invention has the activity of the Cas9 nuclease, is suitable for a CRISPR / Cas9 system and is obtained by deleting 916th phenylalanine of wild type Cas9 nuclease. The Cas9 nuclease (Cas9-delta F916) is adopted for cutting DNA (Deoxyribonucleic Acid) double strands to generate a predominantly-broken terminal; a basic group complemented with the predominantly-broken terminal can be added in a connection filling-in mode, so that accurate edition of a specific position of a genomic DNA fragment can be realized.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a Cas9 nuclease ΔF916 and its application. Background technique [0002] Since the completion of the Human Genome Project and the Encyclopedia of DNA Elements, scientists have analyzed and identified a large number of genes and DNA regulatory elements in the genome [1,2]. DNA regulatory elements that play an important role in the regulation of gene expression include promoters, enhancers, silencers, and insulators. However, the functions of most regulatory elements have not been experimentally verified and elucidated [2-8]. Exploring the function of genes and DNA regulatory elements can be studied through genetic DNA segment editing. [0003] Early gene editing and gene function modification were achieved through gene transposition and transgenesis [9-14]. With the development of sequencing technology, reverse genetics has been applied to make specific mutations in the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/22C12N15/55C12N15/63
CPCC12N9/22C12N15/63C12N2810/10
Inventor 吴强李金环寿佳
Owner SHANGHAI JIAO TONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More