Taq DNA polymerase activity detection method
An activity detection and polymerase technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of large influence of human factors, many operation steps, long time consumption, etc., to promote development, high sensitivity, and operation. easy effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0031] The following examples are intended to illustrate rather than limit the invention.
[0032] Use human single-stranded nucleic acid fragments as templates to detect the DNA polymerase activity of the Taq DNA polymerase to be tested. The specific steps are as follows:
[0033] (1) Design and synthesis of primers and templates
[0034] Referring to the chromosome 16 gene sequence registered on GenBank, design a single-stranded nucleic acid sequence and a primer complementary to the single-stranded nucleic acid:
[0035] Single-stranded nucleic acid sequence: GAGCCCGCCGCCCGGCCCCGCGCAGGCCCCGCCCGGGACTCCCCTGCGGTCCAGGCCGCGCCCCGGGCTCCGCGCCAGCCAATGAGCGCCGCCCGGCCGGGCGTGCCCCCGCGCCCCAAGCATAAACCCTGGCGCGCTCGCGGGCCGGCACTTCTTCTGGTCCCCACAGACTC (SEQ ID NO: 1)
[0036] Primer sequence: 5'-GAGTCTGTGGGGAG-3' (SEQ ID NO: 2), both of which were artificially synthesized.
[0037] (2) Template and primer treatment before PCR reaction
[0038] Dilute the synthesized template and primers to 50 ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



