Unlock instant, AI-driven research and patent intelligence for your innovation.

Taq DNA polymerase activity detection method

An activity detection and polymerase technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of large influence of human factors, many operation steps, long time consumption, etc., to promote development, high sensitivity, and operation. easy effect

Inactive Publication Date: 2017-07-28
GUANGZHOU HEAS BIOTECH CO LTD
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a kind of Taq DNA polymerase activity detection method, and this method is easy and simple to handle, and is accurate, and sensitivity is high, has solved the problem of many operation steps in the prior art, takes a long time, and human factor influence is big, and this technology does not The detection accuracy is affected by the change of Taq enzyme activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Taq DNA polymerase activity detection method
  • Taq DNA polymerase activity detection method
  • Taq DNA polymerase activity detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0031] The following examples are intended to illustrate rather than limit the invention.

[0032] Use human single-stranded nucleic acid fragments as templates to detect the DNA polymerase activity of the Taq DNA polymerase to be tested. The specific steps are as follows:

[0033] (1) Design and synthesis of primers and templates

[0034] Referring to the chromosome 16 gene sequence registered on GenBank, design a single-stranded nucleic acid sequence and a primer complementary to the single-stranded nucleic acid:

[0035] Single-stranded nucleic acid sequence: GAGCCCGCCGCCCGGCCCCGCGCAGGCCCCGCCCGGGACTCCCCTGCGGTCCAGGCCGCGCCCCGGGCTCCGCGCCAGCCAATGAGCGCCGCCCGGCCGGGCGTGCCCCCGCGCCCCAAGCATAAACCCTGGCGCGCTCGCGGGCCGGCACTTCTTCTGGTCCCCACAGACTC (SEQ ID NO: 1)

[0036] Primer sequence: 5'-GAGTCTGTGGGGAG-3' (SEQ ID NO: 2), both of which were artificially synthesized.

[0037] (2) Template and primer treatment before PCR reaction

[0038] Dilute the synthesized template and primers to 50 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Taq DNA polymerase activity detection method comprising design of a template and a primer, preparation of a PCR reaction system, setting of PCR reaction conditions and judgment of activity of a Taq DNA polymerase. The method is easy and convenient to operate, accurate, high in sensitivity, and capable of effectively detecting weak activity of the Taq DNA polymerase. The method solves the problem that an end-point method is multiple in steps, long in time consuming and large in influence caused by human factors, and also solves the problem that accuracy of detection of the activity of Taq enzyme is affected by the change of activity of the Taq enzyme. The Taq DNA polymerase activity detection method disclosed by the invention establishes a detection standard of activity of the Taq DNA polymerase, overcomes the subjectivity and randomness of methods in prior art, and is objective and efficient. The method can be used for promoting the development of related technologies of the Taq DNA polymerase and driving the improvement of PCR related technologies, and has relatively strong practicability. The invention can not only be used for the detection of the activity of the Taq DNA polymerase, but also be used for the detection of the activity of other heat-resistant DNA polymerases, such as Tth DNA polymerases, and pfu DNA polymerases.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for detecting the activity of Taq DNA polymerase. Background technique [0002] Semi-conservative DNA replication is an important way of biological evolution and generation. Double-stranded DNA can be denatured and unwound into a single strand under the action of various enzymes, and with the participation of DNA polymerase, it can be copied into the same two molecular copies according to the principle of complementary base pairing. [0003] The basic principle of PCR technology is similar to the natural replication process of DNA, and its specificity depends on oligonucleotide primers complementary to both ends of the target sequence. It is a molecular biology technique used to amplify specific DNA fragments. It can be regarded as special DNA replication in vitro. Its biggest feature is that DNA will become single-stranded when denatured at high temperature in vitro, and p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/48
CPCC12Q1/48C12Q1/686C12Q2521/101C12Q2563/107
Inventor 刘淑园陈华云肖湘文丁渭赵丽
Owner GUANGZHOU HEAS BIOTECH CO LTD