A strawberry transcription factor that promotes early flowering of plants and its application
A transcription factor, early flowering technology, applied in the fields of genetic engineering and molecular biology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Cloning of Strawberry WRKY46 Gene
[0020] (1) The diploid forest strawberry 'Ruegen' was used as the test material, and the material was grown in a greenhouse.
[0021] (2) RNA extraction: the total RNA of the test material was extracted by the CTAB method, and the whole operation process followed the RNA extraction process of the CTAB method, and then the total RNA was used as a template to reverse transcribe to obtain the first strand of cDNA.
[0022] (3) Cloning of the gene: using the first strand of reverse-transcribed fruit cDNA as a template, PCR amplification was performed using primers WRKY46-F and WRKY46-R, and the PCR product was recovered to obtain a target fragment of 1107 bp.
[0023] WRKY46-F: GCAGGTACCATGTCAAATGAAAAGAAAAGCCC
[0024] WRKY46-R: GCAGAATTCTGGCTCCTCCAGCTTGTGAC
[0025] Note: The first nine bases in the WRKY46-F and WRKY46-R primer sequences, namely GCAGGTACC and GCAGAATTC, are required for the construction of vectors, artificially added r...
Embodiment 2
[0027] Construction of plant expression vectors
[0028] (1) After the target fragment was recovered from the gel, it was connected to the pMD18-T vector (purchased from TaKaRa Company), and then transformed into Escherichia coli competent cells Trans5α (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), and positive single colonies were screened, Plasmids were extracted and sequenced.
[0029] (2) EcoRI and KpnⅠ were used to double-enzyme digest the correctly sequenced WRKY46-pMD18-T recombinant plasmid and pRI101-GFP plasmid respectively, recover the large vector fragment and the target gene fragment, and transform Escherichia coli Trans5α competent cells after ligation with T4 ligase (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), after identifying the recombinant, a plant expression vector with the gene of interest was obtained.
Embodiment 3
[0031] Transformation of Arabidopsis for functional verification
[0032] (1) Infect Arabidopsis thaliana by flower dipping method.
[0033] Pick a positive clone of Agrobacterium GV3101 containing the target gene WRKY46, inoculate it in the liquid YEP medium of LB+Kan (kanamycin) 50mg / L+Rif (rifampicin) 25mg / L, and culture with shaking at 28°C 200rpm At 24 hours, take 1ml of the cultured bacteria liquid and add 50ml of liquid YEP medium to activate, so that OD 600 = about 0.8.
[0034] Transfer the bacterial solution into a sterile 50ml centrifuge tube, centrifuge at 5000rpm for 10min to collect the bacterial species, and then resuspend the bacteria with the same volume of MS resuspension (1 / 2MS+0.5g / L MES+5%Sucrose, pH5.7) Agrobacterium was suspended, and the surfactant Silwet was added to make the final concentration 0.03% (300 μl / L).
[0035] Soak the inflorescences of Arabidopsis plants that have just bloomed in this solution for 30s. The inflorescence cover membrane o...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


