Specifically-targeted swine IGFBP3 gene sgRNA targeting sequence and application

A kind of specific and sequence technology, applied in sgRNA guide sequence and application field, can solve the problems of mouse weight gain, expression level increase, content increase, etc., and achieve high safety and eliminate expression effect

Inactive Publication Date: 2017-08-29
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF2 Cites 31 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The emergence of these phenotypes is generally considered to be due to the compensatory effect of the IGFBP2 gene after the knockout of the IGFBP3 gene.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specifically-targeted swine IGFBP3 gene sgRNA targeting sequence and application
  • Specifically-targeted swine IGFBP3 gene sgRNA targeting sequence and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] (1) sgRNA design

[0029] According to the genome sequence of porcine IGFBP3 gene (gene ID: 001005156), a sgRNA targeting porcine IGFBP3 gene was designed. The 20nt oligonucleotide sgRNA guide sequence is: IGFBP3-sgRNA1:5'-CGTCTCGCGCTTGGACTCAG-3', located in the second exon of the gene IGFBP3; add CACC to its 5' end to obtain the forward oligonucleotide sequence; according to The targeting sequence gets its corresponding DNA complementary strand, and AAAC is added to its 5' end to get the reverse oligonucleotide. Synthesize the above forward oligonucleotides and reverse oligonucleotides respectively, and synthesize the forward and reverse sgRNA oligonucleotide sequences: denature at 95°C for 5 minutes, and anneal at 72°C for 10 minutes; after annealing, sticky ends can be formed The specific oligonucleotide sequence is shown in Table 1.

[0030] Oligonucleotide sequence of table 1 sgRNA guide sequence

[0031]

Nucleotide sequence (5' to 3')

Sg1-F ...

Embodiment 2

[0037] (1) Acquisition of G418 resistance gene

[0038] Primers were designed according to the G418 resistance gene in the plasmid pEGFP-C1 vector, and a BsmBI restriction site was added to the 5' end of the primer oligonucleotide sequence, Kana-F: 5-GGCGTCTCCGGGATGTGCGCGGAACCCCTATTTG-3, Kana-R: 5-GGCGTCTCGCGCCAATTCTAAAGTATATGAGTAACC-3, Synthesize the upstream and downstream primer sequences respectively, and use the plasmid pEGFP-C1 as a template for PCR amplification. The PCR reaction system is 50 μL: pEGFP-C1 plasmid 1 μL, 2×PCRMix 25 μL, upstream and downstream primers 1 μL each, ddH 2 O 22 μL. The PCR reaction conditions were: 94°C for 5min, 94°C for 30s, 60°C for 45s, 72°C for 1min40s, a total of 33 cycles, followed by an extension at 72°C for 10min. The obtained DNA fragment was named Kana.

[0039] Table 2 Amplifies the primer sequence of Kana fragment

[0040]

Sequence (5' to 3')

Kana-F

GGCGTCTCCGGGATGTGCGCGGAACCCCTATTTG

Kana-R

G...

Embodiment 3

[0044] (1) Culture of porcine fibroblasts

[0045] For methods of isolation and culture of pig fetal fibroblasts, please refer to literature: Xinjige; Cheng Wenmin; Pan Weirong; Qing Yubo; Zha Xingqin; Fu Guowen; Wei Hongjiang; Zeng Yangzhi. Research on culture methods of pig fetal fibroblasts and ear skin fibroblasts, Heilongjiang Animal Husbandry and Veterinary Medicine, 2013(9): 175-179.

[0046] (2) Plasmid transfection and positive cell selection

[0047] The recombinant plasmid pX330-G418-IGFBP3-Sg1 was transfected into pig fetal fibroblasts by liposome transfection to obtain recombinant cells. For specific steps of transfection, refer to the operation manual of Liposome 3000 (Invitrogen, catalog number: 11668019) for transfection.

[0048] The transfected cells were screened with 1000ng / mL G418 for 10 days, and the screened cells were cultured and frozen.

[0049] (3) Identification of gene knockout effect

[0050] Design primers for identification according to the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a sgRNA targeting sequence and application, in particular to a specifically-targeted swine IGFBP3 gene sgRNA targeting sequence and application. The sgRNA targeting sequence is CGTCTCGCGCTTGGACTCAG. By the sgRNA targeting sequence, an IGFBP3 gene can be knocked out or edited through a CTISPR / Cas9 system so as to eliminate IGFBP3 expression to lay the foundation for preparation of IGFBP3 transgenic swine. The specifically-targeted swine IGFBP3 gene sgRNA targeting sequence is applied to the field of gene engineering.

Description

technical field [0001] The invention relates to a sgRNA guide sequence and its application. Background technique [0002] The CRISPR / cas9 gene editing system is modified based on the class II CRISPR / Cas system. Cas9 protein is the only Cas protein required to mediate silencing of foreign DNA. In 2012, Jinek confirmed through in vitro experiments that the cutting of the protospacer sequence by the Cas9 protein requires not only a mature crRNA complementary to the protospacer sequence, but also tracrRNA; by sequencing the cleaved fragments, it was found that tracrRNA:crRNA guides the cleavage site of the Cas9 protein The point is site-specific, whether it is a circular plasmid or a linear DNA fragment, the cutting site is at the 3bp upstream of the PAM sequence; the Cas9 protein contains HNH and RuvC endonuclease domains, no matter which domain is mutated , are unable to cut effectively, but only produce nicks on double-stranded DNA. Experiments have confirmed that the HNH d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/85C12N15/90
CPCC07K14/4743C12N9/22C12N15/113C12N15/85C12N15/907C12N2310/10C12N2810/10
Inventor牟彦双刘忠华尹智翁晓刚
OwnerNORTHEAST AGRICULTURAL UNIVERSITY