Artificial gene editing system for rice

A gene editing and artificial technology, applied in the field of artificial gene editing system, can solve the problems of low editing efficiency and base editing efficiency limitation

Active Publication Date: 2022-01-11
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The most commonly used PAM sequence recognized by SpCas9 is mainly NGG, although SpCas9 can also recognize NAG, and SpCas9 (VQR) can recognize NGA, etc., but its editing efficiency is low; at the same time, bases developed based on the CRISPR / SpCas9 system Editing technology will also be limited by the specificity of the edited target site and the possibility of not having a suitable PAM sequence, which greatly limits the application of the CRISPR / Cas9 system in rice genome editing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Artificial gene editing system for rice
  • Artificial gene editing system for rice
  • Artificial gene editing system for rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Construction of recombinant plasmids

[0064] The technical route for constructing the carrier is as follows:

[0065] 1.1 pUbi:Cas9NG recombinant plasmid construction

[0066] Determine the amino acid sequence of Cas9NG as shown in SEQ ID No.1, and determine the gene sequence SEQ ID No.5 for expression in rice according to the amino acid sequence of Cas9NG, and artificially synthesize the 4299bp gene sequence shown in SEQ ID No.5 The nucleotide sequence was cloned into pUC57 and named as pUC57:Cas9NG (completed by Beijing Qingke Xinye Biotechnology Co., Ltd.). Then SEQ ID No.12 (maize ubiquitin promoter UbiP), SEQ ID No.5, SEQ ID No.14 (Nos terminator) are cloned into the pCAMBIA1300 vector according to the direction from 5' to 3', named pUbi: Cas9NG.

[0067] The main components of the plasmid pUbi:Cas9NG are as follows: CaMV35S promoter (genebank accession number is FJ362600.1, nucleotide sequence from 10382 to 11162), hygromycin gene (genebank accession number is K...

Embodiment 2

[0080] Example 2: Knockout of rice endogenous gene OsCERK1 using pUbi:Cas9NG

[0081] 2.1 Design and cloning of recognition sequence for OsCERK1 gene

[0082] The transcript sequence and genome sequence of the OsCERK1 (LOC_Os08g42580) gene were obtained from the MSU / TIGR rice genome database ( http: / / rice.plantbiology.msu.edu / ).

[0083] For the OsCERK1 gene, the target nucleotide sequence (SEQ ID No.16: ggccttccttg ggatcc ggcga, underlined BamH I restriction site, bolded PAM sequence) primers are as follows: gOsCERK1-F1 (SEQ ID No. 26: tgttggccttccttgggatccgg) and gOsCERK1-R1 (SEQ ID No. 27: aaacccggatcccaaggaaggcc). After synthesizing the primers, use T4 polynucleotide kinase to phosphorylate the primers, anneal to form double strands, clone gOsCERK1-F1 / R1 into the BtgZ I restriction site of the pENTR4:sgRNA vector, and confirm that the inserted fragment is complete by sequencing. Correct, named pENTR4:sgRNA-gOsCERK1.

[0084] 2.2 PEG-mediated pUbi:Cas9NG system trans...

Embodiment 3

[0091] Example 3: Base C to T substitution of rice endogenous gene OsRLCK185 using pUbi:rBE22

[0092] The transcript sequence and genome sequence of the OsRLCK185 (LOC_Os05g30870) gene were obtained from the MSU / TIGR rice genome database ( http: / / rice.plantbiology.msu.edu / ).

[0093] For the OsRLCK185 gene, the design contains the target nucleotide sequence (SEQ ID No.17: gtgcac tgccaagctcacactgc, the underline is the Alw44 I restriction site, and the bold PAM sequence) primers are as follows: gOsRLCK185-F1 (SEQ ID No. 30: gtgtgtgcactgccaagctcacac) and gOsRLCK185-R1 (SEQ ID No. 31: aaacgtgtgattggcagtgcac). After synthesizing the primers, use T4 polynucleotide kinase to phosphorylate the primers, anneal to form double strands, clone gOsRLCK185-F1 / R1 into the Bsa I restriction site of the pENTR4:sgRNA vector, and sequence to confirm that the inserted fragment is complete. Correct, named pENTR4:sgRNA-gOsRLCK185.

[0094] Other operations are the same as in Example 2.

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present application relates to a set of artificial gene editing system for gene editing of rice, comprising: a regulatory element I comprising a nucleotide sequence capable of encoding an amino acid sequence I, the amino acid sequence I comprising one of an amino acid sequence I-1, an amino acid sequence I-2 and an amino acid sequence I-3; and a regulatory element II which comprises an II-1 nucleotide sequence and an II-2 nucleotide sequence which are sequentially connected in series from the 5' end to the 3' end. The II-1 nucleotide sequence comprises a target nucleotide sequence; the target nucleotide sequence is derived from a genome of a target organism, and the target nucleotide sequence contains a target site to be mutated in the genome of the target organism; the (II-2)th nucleotide sequence comprises an sgRNA nucleic acid sequence derived from streptococcus pyogenes; and the (II-1)th nucleotide sequence and the (II-2)th nucleotide sequence are transcribed and fused.

Description

[0001] This application is a divisional application submitted on November 07, 2018, with the title of invention being an artificial gene editing system for rice, and the application number being 201811320030.8. technical field [0002] This application relates to a set of artificial gene editing system for rice. Background technique [0003] Rice (Oryza sativa L.) is one of the world's major food crops, feeding nearly half of the world's population, including almost the entire population of East and Southeast Asia. China is the country with the highest total rice output in the world, accounting for about 30% of the global total. In the production process, the three major diseases of rice, mainly rice blast, rice smut and sheath blight, seriously restrict the growth and development of rice, resulting in a decrease in rice yield and quality, threatening global food security. Therefore, it is a major issue for the sustainable development of human society to increase the yield,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/29A01H5/10A01H6/46
CPCC12N15/8216C07K14/415Y02A40/146
Inventor 周焕斌柳浪
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap