Mutant A type DNA (deoxyribonucleic acid) polymerase, and encoding gene and application of mutant A type DNA polymerase

A technology of polymerase and mutation, applied in the field of molecular biology, can solve the problems of low incorporation rate, limitation of application fields, low amplification efficiency of target products, etc., and achieve the effect of improving incorporation efficiency and preventing pollution

Active Publication Date: 2017-10-27
SUZHOU NUHIGH BIOTECH
View PDF3 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The problem with this current system is that when dUTP is used instead of dTTP, the incorporation rate of dUTP by wild-type Taq DNA polymerase is much lower than that of dTTP, resulting in lower amplification efficiency of the target product, so it is necessary to increase the amount of dUTP added 2 to 3 times to increase the amplification efficiency of Taq DNA polymerase to the target product (for example: dATP:dGTP:dCTP:dUTP=1:1:1:2 and dATP:dGTP:dCTP:dUTP=1:1:1: 3)
Therefore, in the system where dUTP is used instead of dTTP for nucleic acid amplification, the structural defect of wild-type Taq DNA polymerase limits its application in this field

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant A type DNA (deoxyribonucleic acid) polymerase, and encoding gene and application of mutant A type DNA polymerase
  • Mutant A type DNA (deoxyribonucleic acid) polymerase, and encoding gene and application of mutant A type DNA polymerase
  • Mutant A type DNA (deoxyribonucleic acid) polymerase, and encoding gene and application of mutant A type DNA polymerase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Embodiment 1: the preparation of mutant Taq enzyme

[0080] Using the commercialized pTrc99A plasmid (see the plasmid map image 3 ), the target fragment of Taq polymerase was constructed through ncoI and pstI two restriction sites, the mutant enzyme adopts the method of site-directed mutagenesis, and the 5' ends of the upstream and downstream primers are complementary and coincident with 10-15 bases for mutation, and the whole plasmid PCR is carried out.

[0081] Primer sequence (sequence as in SEQ ID NO: 12-39):

[0082] 664L upstream: GGCCAAGCTCATCAACTTCGGGGTCCTCTACGG

[0083] Downstream of 664L: GATGAGCTTGGCCGCCCGGCGCAT

[0084] 664I Upstream: GGCCAAGATCATCAACTTCGGGGTCCTCTACGG

[0085] Downstream of 664I: GATGATCTTGGCCGCCCGGCGCAT

[0086] 664M upstream: GGCCAAGATGATCAACTTCGGGGTCCTCTACGG

[0087] 664M Downstream: GATCATCTTGGCCGCCCGGCGCAT

[0088] 660Y upstream: CGCTATGCGGCCAAGACCATCAACTTCGG

[0089] Downstream of 660Y: TGGCCGCATAGCGCATCAGGGGGTC

[0090] 661T ...

Embodiment 2

[0112] Example 2: Comparison of the amplification efficiencies of the mutant 142N (T664v) and wild-type 142N using dUTP and dTTP as substrates for target products

[0113] In this example, the amplification efficiencies of the mutant 142N (T664V) and wild-type 142N using dUTP and dTTP as substrates for the target product were compared. The template used was M13 phage DNA (SEQ ID NO: 40). 550ng / ul, the amplification products were 1000bp and 500bp in size.

[0114] The amplified product is the primer sequence of the 1000bp system

[0115] Upstream primer TACAGTCTGACGCTAAAGGCAAA (SEQ ID NO: 41)

[0116] Downstream primer GTACCGCACTCATCGAGAACAAG (SEQ ID NO: 42)

[0117] The primer sequence of the amplification product is 500bp system:

[0118] Upstream primer ATGGTAATGGTGCTACTGGTGATTT (SEQ ID NO: 43)

[0119] Downstream primer CAAAGTCAGAGGGTAATTGAGCG (SEQ ID NO: 44)

[0120] The PCR reaction system is 25ul, each of dATP, dCTP, dGTP, dTTP or dUTP contains 200uM, the concentrat...

Embodiment 3

[0128] Example 3: Comparison of amplification efficiencies of target products when mutant Taq enzymes (T664N, A661V, R660Y, T664V, A661T) and wild-type Taq enzymes use different ratios of dATP:dGTP:dCTP:dUTP as substrates

[0129] In this example, referring to Example 2, the system was compared with different mutant Taq enzymes (T664N, A661V, R660Y, T664V, A661T) and wild-type Taq enzymes when dUTP and dTTP were used as substrates for the target product M13 phage DNA amplification efficiency. The primer sequence dATP:dGTP:dCTP:dUTP with an amplification product of 500bp is 1:1:1:2 and 1:1:1:3.

[0130] PCR thermocycling conditions were 95°C, 30s; 30cycles (95°C, 5s; 60°C, 10s, 72°C, 40s single).

[0131] See the experimental results Image 6 , the experimental results are reflected by the brightness of the electrophoretic bands of the amplified products.

[0132] Image 6 It can be seen that when the ratio of dATP:dGTP:dCTP:dUTP is 1:1:1:2 and 1:1:1:3, neither the mutant T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular biology and discloses mutant A type DNA (deoxyribonucleic acid) polymerase, and an encoding gene and an application of the mutant A type DNA polymerase. The mutant A type DNA polymerase is generated by amino acid site mutation of conservational motif of A type DNA polymerase in a dNTP (deoxyribonucleoside triphosphate) bond zone. Compared with the A type DNA polymerase not modified or mutated, the mutant A type DNA polymerase has increased dUTP (deoxyuridine triphosphokinase) doping speed; a dUTP doping effect of the mutant A type DNA polymerase is obviously better than control A type DNA polymerase; therefore, the mutant A type DNA polymerase is more applicable to some nucleic acid amplification systems using dUTP to substitute dTTP (deoxy- thymidine triphosphate) and allows the system to avoid nucleic acid amplification product contamination and not to lose amplification efficiency of a target product at the same time; and the mutant A type DNA polymerase meets application requirements of multiple PCR (polymerase chain reaction) fields of food, animal quarantine, human disease screening and the like, a forensic medicine field and a scientific research.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a mutant A-type DNA polymerase, its coding gene and its application. Background technique [0002] DNA polymerase uses the nucleotide chain as a template to incorporate dNTP into the newly synthesized nucleotide chain by forming a new '3-5' phosphodiester bond in the presence of magnesium ions, thereby replicating DNA. In vivo, DNA polymerase participates in complex reactions including DNA replication and DNA repair. In vitro, by PCR (polymerase chain reaction) technology, DNA polymerase can synthesize DNA in large quantities. [0003] As the most basic enzymatic reaction of DNA life, DNA polymerase has evolved with the evolution of life. All DNA polymerase families share a common double bivalent ion catalytic center, but differ considerably in other structures. Regardless of the apparent differences in the conformation of these DNA polymerases, all polymerase struct...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/10
CPCC12N9/1252C12N15/10C12Y207/07007
Inventor何文龙毕万里王志清陈剑峰刘连弟
OwnerSUZHOU NUHIGH BIOTECH