Supercharge Your Innovation With Domain-Expert AI Agents!

Primer probe, kit and method for accurate and quantitative detection of specific gene component of transgenic rice oryza sativa l line

A kind of rice-graining and specific technology, which is applied in biochemical equipment and methods, microbial measurement/inspection, DNA/RNA fragments, etc., can solve the problems of increased detection difficulty and large quantity, and achieve accurate and sensitive results. Accurate quantitative results and high detection sensitivity

Inactive Publication Date: 2017-11-03
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the large number and variety of genetically modified foods, especially after many genetically modified foods are processed and stored under various conditions, the genetically modified ingredients are degraded in large quantities, making detection more difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer probe, kit and method for accurate and quantitative detection of specific gene component of transgenic rice oryza sativa l line
  • Primer probe, kit and method for accurate and quantitative detection of specific gene component of transgenic rice oryza sativa l line
  • Primer probe, kit and method for accurate and quantitative detection of specific gene component of transgenic rice oryza sativa l line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] For the first time, the inventors of the present invention amplified the specific gene of the transgenic rice gram borer rice line by real-time fluorescent PCR (probe method). The probe sequence of the specific gene primers used for the transgenic Oryza japonica rice line is the upstream primer KMD-LFTCCGCAATGTGTTATTAAGTTGTCTAA (SEQ ID No.1), and the downstream primer is KMD-LR CCGATATGCCTGCCCATCT (SEQ ID No.2); the probe is KMD- LP CGTCAATTTGTTTACACCCACAATATATCCCG (SEQ ID No. 3).

[0026] 1. Main testing instruments used:

[0027] Micropipette (eppendorf), fluorescent quantitative PCR instrument (AB7500), high-speed desktop centrifuge (12 000 r / min), electrophoresis instrument (DYY22C type), etc.

[0028] 2. Main reagents for detection:

[0029] 2×TaqMan Universal PCR Master Mix (ABI), primer probe (Thermofisher), etc.

[0030] 3. Main steps of detection:

[0031] Real-time fluorescent PCR reaction system:

[0032] 2×Mastermix 12.5μL

[0033] Upstream primer (10m...

Embodiment 2

[0046] In this example, the gene copy number of transgenic rice was quantitatively detected by digital PCR by using the specific primer probe sequence of the transgenic rice Oryza sativa. The probe sequence of the transgenic O. japonica strain-specific primer used is that the upstream primer is KMD-LF TCCGCAATGTGTTATTAAGTTGTCTAA (SEQ ID No.1), and the downstream primer is KMD-LRCCGATATGCCTGCCCATCT (SEQ ID No.2); the probe is KMD-LP CGTCAATTTGTTTACACCCACAATATATCCCG (SEQ ID No. 3).

[0047] 1. Main testing instruments used:

[0048] Micropipette (eppendorf), droplet digital PCR instrument (Bio-rad, QX200), high-speed desktop centrifuge (12000 r / min), etc.

[0049] 2. Main reagents for detection:

[0050] 2×TaqMan Master Mix (Bio-rad), primer probe (Thermofisher), etc.

[0051] 3. Main steps of detection:

[0052] Digital PCR reaction system:

[0053] 2×Mastermix 10 μL

[0054] Upstream primer (10mM) 1.0μL

[0055] Downstream primer (10mM) 1.0μL

[0056] Probe (10mM) 0.5μ...

Embodiment 3

[0065] Same as the method described in Example 2, the genomic DNA of the transgenic rice sample was diluted 1-fold, 5-fold and 50-fold respectively as a template, each dilution gradient was repeated 3 times, and the primer probe sequence was amplified using the transgenic rice The same as in Example 2, digital PCR quantitative detection was carried out to determine the sensitivity of the method.

[0066] The average contents of genomic DNA stock solution, 5-fold dilution and 50-fold dilution of transgenic rice samples were 551 copies / μL, 106.4 copies / μL, and 13.2 copies / μL, respectively, and the deviations from the theoretical values ​​were -4.67%, 0.15%, and 1.74%, respectively. It basically conformed to its theoretical copy number, and the RSD values ​​of three repetitions of each dilution gradient were 1.07%, 6.92%, and 7.35% ( image 3 ), indicating that the precise quantitative detection method has good accuracy and sensitivity in detecting the specific gene components of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to an oligonucleotide primer probe for accurate and quantitative detection of the specific gene component of a transgenic rice oryza sativa l line, and a kit containing the primer probe. The invention further relates to a digital PCR detection method for quantitatively detecting the specific gene component of a transgenic rice oryza sativa l line, wherein the method comprises using the specific oligonucleotide primer and the fluorescent label probe for the specific gene of the transgenic rice oryza sativa l line. The present invention further relates to applications of the specific oligonucleotide primer and the fluorescent probe for the specific gene of the transgenic rice line in quantitative detection of the specific gene component of the transgenic rice oryza sativa l line. According to the present invention, by using the digital PCR detection method, the content of the specific gene component of the transgenic rice oryza sativa l line in the sample can be accurately and sensitively determined, and the sensitivity can achieve 0.5 copies / [mu]L.

Description

technical field [0001] The invention belongs to the field of biotechnology, specifically, the invention relates to oligonucleotide primers and fluorescent labeling probes for the detection of specific gene components of transgenic rice gram borer rice strains, a kit containing the primer probes, used The digital PCR detection method for the determination of the specific gene components of the transgenic O. Application in sex gene components. Background technique [0002] With the extensive research on genetically modified products and their wide application in daily life, the safety issues brought by genetically modified products to human health and living environment have aroused widespread concern and controversy in the world. Therefore, while actively researching genetically modified technology, various countries in the world have also conducted a lot of research on the detection and analysis methods of various genetically modified foods. However, due to the large num...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6851C12Q1/6895C12Q2531/113C12Q2561/101
Inventor 黄文胜陈颖邓婷婷葛毅强周杰吴亚君
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More