Primer probe, kit and method for accurate and quantitative detection of specific gene component of transgenic rice oryza sativa l line
A kind of rice-graining and specific technology, which is applied in biochemical equipment and methods, microbial measurement/inspection, DNA/RNA fragments, etc., can solve the problems of increased detection difficulty and large quantity, and achieve accurate and sensitive results. Accurate quantitative results and high detection sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] For the first time, the inventors of the present invention amplified the specific gene of the transgenic rice gram borer rice line by real-time fluorescent PCR (probe method). The probe sequence of the specific gene primers used for the transgenic Oryza japonica rice line is the upstream primer KMD-LFTCCGCAATGTGTTATTAAGTTGTCTAA (SEQ ID No.1), and the downstream primer is KMD-LR CCGATATGCCTGCCCATCT (SEQ ID No.2); the probe is KMD- LP CGTCAATTTGTTTACACCCACAATATATCCCG (SEQ ID No. 3).
[0026] 1. Main testing instruments used:
[0027] Micropipette (eppendorf), fluorescent quantitative PCR instrument (AB7500), high-speed desktop centrifuge (12 000 r / min), electrophoresis instrument (DYY22C type), etc.
[0028] 2. Main reagents for detection:
[0029] 2×TaqMan Universal PCR Master Mix (ABI), primer probe (Thermofisher), etc.
[0030] 3. Main steps of detection:
[0031] Real-time fluorescent PCR reaction system:
[0032] 2×Mastermix 12.5μL
[0033] Upstream primer (10m...
Embodiment 2
[0046] In this example, the gene copy number of transgenic rice was quantitatively detected by digital PCR by using the specific primer probe sequence of the transgenic rice Oryza sativa. The probe sequence of the transgenic O. japonica strain-specific primer used is that the upstream primer is KMD-LF TCCGCAATGTGTTATTAAGTTGTCTAA (SEQ ID No.1), and the downstream primer is KMD-LRCCGATATGCCTGCCCATCT (SEQ ID No.2); the probe is KMD-LP CGTCAATTTGTTTACACCCACAATATATCCCG (SEQ ID No. 3).
[0047] 1. Main testing instruments used:
[0048] Micropipette (eppendorf), droplet digital PCR instrument (Bio-rad, QX200), high-speed desktop centrifuge (12000 r / min), etc.
[0049] 2. Main reagents for detection:
[0050] 2×TaqMan Master Mix (Bio-rad), primer probe (Thermofisher), etc.
[0051] 3. Main steps of detection:
[0052] Digital PCR reaction system:
[0053] 2×Mastermix 10 μL
[0054] Upstream primer (10mM) 1.0μL
[0055] Downstream primer (10mM) 1.0μL
[0056] Probe (10mM) 0.5μ...
Embodiment 3
[0065] Same as the method described in Example 2, the genomic DNA of the transgenic rice sample was diluted 1-fold, 5-fold and 50-fold respectively as a template, each dilution gradient was repeated 3 times, and the primer probe sequence was amplified using the transgenic rice The same as in Example 2, digital PCR quantitative detection was carried out to determine the sensitivity of the method.
[0066] The average contents of genomic DNA stock solution, 5-fold dilution and 50-fold dilution of transgenic rice samples were 551 copies / μL, 106.4 copies / μL, and 13.2 copies / μL, respectively, and the deviations from the theoretical values were -4.67%, 0.15%, and 1.74%, respectively. It basically conformed to its theoretical copy number, and the RSD values of three repetitions of each dilution gradient were 1.07%, 6.92%, and 7.35% ( image 3 ), indicating that the precise quantitative detection method has good accuracy and sensitivity in detecting the specific gene components of...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap