Primer probe, kit and method for accurate and quantitative detection of specific gene component of transgenic rice M12 line

A specific, M12 technology, applied in the field of biotechnology, can solve the problems of large quantity and increased detection difficulty, and achieve the effect of accurate quantitative results, accurate and sensitive results, and strong specificity

Inactive Publication Date: 2017-11-03
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the large number and variety of genetically modified foods, especially after many genetically modified foods are processed and stored under various conditions, the genetically modified ingredients are degraded in large quantities, making detection more difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer probe, kit and method for accurate and quantitative detection of specific gene component of transgenic rice M12 line
  • Primer probe, kit and method for accurate and quantitative detection of specific gene component of transgenic rice M12 line
  • Primer probe, kit and method for accurate and quantitative detection of specific gene component of transgenic rice M12 line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] The inventors of the present invention for the first time amplified transgenic rice M12 line-specific genes by real-time fluorescent PCR (probe method). The probe sequence of the transgenic rice M12 strain-specific gene primer used was upstream primer RB-F2 CTAGAGGATCCCGGACGAGTG (SEQ ID No.1), downstream primer RB-R2ATGAGTGGTAGCGTCCAGAAGGAAA (SEQ ID No.2); the probe was RB-P2CTGGGGCAGATAAGCAGTAGTGGTGGG (SEQ ID No. ID No.3).

[0026] 1. Main testing instruments used:

[0027] Micropipette (eppendorf), fluorescent quantitative PCR instrument (AB7500), high-speed desktop centrifuge (12 000 r / min), electrophoresis instrument (DYY22C type), etc.

[0028] 2. Main reagents for detection:

[0029] 2×TaqMan Universal PCR Master Mix (ABI), primer probe (Thermofisher), etc.

[0030] 3. Main steps of detection:

[0031] Real-time fluorescent PCR reaction system:

[0032] 2×Mastermix 12.5μL

[0033] Upstream primer (10mM) 1.0μL

[0034] Downstream primer (10mM) 1.0μL

[0035...

Embodiment 2

[0046] In this example, the gene copy number of transgenic rice was quantitatively detected by digital PCR by using the specific primer probe sequence of the transgenic rice M12 strain. The probe sequence of the transgenic rice M12 strain-specific primer used is the upstream primer M12-F1 GAGAACAAGAAGCCCCTTCTGTCTCG (SEQ ID No.1), and the downstream primer is M12-R1AAGGTACTAAAGCTTGAAAATCCTAAGGC (SEQ ID No.2); the probe is M12 - P1CACATTCGGCAGTGAAACTCTTGAGCGCC (SEQ ID No. 3).

[0047] 1. Main testing instruments used:

[0048] Micropipette (eppendorf), droplet digital PCR instrument (Bio-rad, QX200), high-speed desktop centrifuge (12000 r / min), etc.

[0049] 2. Main reagents for detection:

[0050] 2×TaqMan Master Mix (Bio-rad), primer probe (Thermofisher), etc.

[0051] 3. Main steps of detection:

[0052] Digital PCR reaction system:

[0053] 2×Mastermix 10 μL

[0054] Upstream primer (10mM) 1.0μL

[0055] Downstream primer (10mM) 1.0μL

[0056] Probe (10mM) 0.5μL

[...

Embodiment 3

[0065] The method is the same as that described in Example 2, except that the genomic DNA of the transgenic rice sample is first diluted 5 times and then diluted 10 times in 3 gradients as a template, and each dilution gradient is repeated 3 times, using transgenic rice M12 amplification primers The probe sequence was the same as that in Example 2, and quantitative detection by digital PCR was carried out to determine the sensitivity of the method.

[0066] Such as Figure 4 As shown, when the blank control (sterile double distilled water) has no amplification signal, the contents of the stock solution and its diluted 2.5 times, 5 times, and 10 times are 636 copies / μL, 211.33 copies / μL, 135.67 copies / μL, 74.47copies / μL, the deviation is between -6.20%-14.48%, which is basically in line with its theoretical copy number, and the RSD value of the three repetitions of each dilution gradient is between 0.49%-3.02% ( Figure 4 ), indicating that the precise quantitative detection m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to an oligonucleotide primer probe for accurate and quantitative detection of the specific gene component of a transgenic rice M12 line, and a kit containing the primer probe. The invention further relates to a digital PCR detection method for quantitatively detecting the specific gene component of a transgenic rice M12 line, wherein the method comprises using the specific oligonucleotide primer and the fluorescent label probe for the specific gene of the transgenic rice M12 line. The present invention further relates to applications of the specific oligonucleotide primer and the fluorescent probe for the specific gene of the transgenic rice line in quantitative detection of the specific gene component of the transgenic rice M12 line. According to the present invention, by using the digital PCR detection method, the content of the specific gene component of the transgenic rice M12 line in the sample can be accurately and sensitively determined, and the sensitivity can achieve 1 copies / [mu]L.

Description

technical field [0001] The invention belongs to the field of biotechnology. Specifically, the invention relates to oligonucleotide primers and fluorescent labeling probes for the detection of specific gene components of transgenic rice M12 strains, and a kit containing the primer probes for determining The digital PCR detection method of the specific gene components of the transgenic rice M12 line and the application of the specific oligonucleotide primers and probes of the specific gene components of the transgenic rice M12 line in the sample to the detection of the specific gene components of the transgenic rice M12 line. Background technique [0002] With the extensive research on genetically modified products and their wide application in daily life, the safety issues brought by genetically modified products to human health and living environment have aroused widespread concern and controversy in the world. Therefore, while actively researching genetically modified techn...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6851C12Q1/6895C12Q2563/107
Inventor陈颖邓婷婷黄文胜葛毅强聂丹丹芦云
OwnerCHINESE ACAD OF INSPECTION & QUARANTINE