Unlock instant, AI-driven research and patent intelligence for your innovation.

Mini-gene splicing reporter plasmid and construction method and application thereof

A technology of reporter plasmid and construction method, applied in the field of mini-gene splicing reporter plasmid and its construction, can solve problems such as difficulty in grasping the relationship between mutation, splicing and splicing and diseases

Active Publication Date: 2017-11-24
NANKAI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, due to various mutations in human genes, it is difficult to know whether these mutations will affect the splicing of genes, which brings difficulties to grasp the relationship between mutations and splicing, as well as between splicing and diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mini-gene splicing reporter plasmid and construction method and application thereof
  • Mini-gene splicing reporter plasmid and construction method and application thereof
  • Mini-gene splicing reporter plasmid and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Construction process of minigene splicing reporter plasmid

[0038] The non-contiguous sequences on the three DMD genes were obtained by PCR amplification, and were respectively inserted into pcDNA3.1 to construct the minigene reporter plasmid NKU-YC-1.

[0039] Materials and Reagents:

[0040] The vector pcDNA3.1 was purchased from Invitrogen, the LB culture plate and culture medium were purchased from Shanghai Sangon Biological Company, the competent Trans1-T1 was purchased from Quanshijin Bio Company, and the agarose recovery kit and T4 ligase were purchased from NEB Bio Company , the restriction endonucleases used in the experiment were purchased from TAKARA Biological Company.

[0041] (1) Using the genomic DNA of a normal person as a template, design primers Y1F-NheI (sequence shown in Sequence Listing 3) and Y1R-KpnI (sequence shown in Sequence Listing 4) for PCR amplification. The primers are as follows (where the underline is the restriction site):

[0042] ...

Embodiment 2

[0060] Construction method of mutant mini-gene

[0061] Design primers M-F: GTGGGCAGTAGATAAAGAATGAAGC

[0062] M-R:CTTTATCTACTGCCCACCTTCATTG

[0063] Using the NKU-YC-1 plasmid as a template, design primers M-F (sequence shown in Sequence Listing 9) and M-R (sequence shown in Sequence Listing 10) for PCR amplification. The primers are as follows:

[0064] M-F: GTGGGCAGTAGATAAAGAATGAAGC

[0065] M-R:CTTTATCTACTGCCCACCTTCATTG

[0066]

[0067] After mixing the components, put them into the PCR machine. PCR reaction parameters: pre-denaturation at 94°C for 5min, denaturation at 94°C for 30s, annealing at 60°C for 30s, extension at 72°C for 10min, 35 cycles, and stop extension at 72°C for 5min. After the reaction was completed, 5 ul of the PCR product was taken for electrophoresis to detect the amplified product fragment, and the fragment size was about 5 kb. Take 20ul of the PCR product for DpnI enzyme digestion and digestion. The enzyme digestion system is as follows:

...

Embodiment 3

[0071] Functional validation of a mini-gene splicing reporter system

[0072] 1) The plasmid NKU-YC-1 was transfected into Hela cells by a liposome-mediated method. The transfection reagent used liposome Lipo2000 from Invitrogen Company. The transfection method refers to the instructions of the transfection reagent. The specific operations are as follows:

[0073] The night before, add 0.5ug plasmid and 8ul transfection reagent to 200ul serum-free medium, incubate at room temperature for 5min, so that the liposomes can fully wrap the plasmid, then add it to 2ml well-grown Hela cells, place in The incubator was cultured overnight, and the serum-free medium was replaced with serum-containing medium the next morning to continue culturing.

[0074] 2) RNA extraction: 48 hours after transfection, aspirate the culture medium, wash twice with PBS, add 500ul Trizol to wash repeatedly, and transfer to a 1.5ml centrifuge tube. Add 100ul of chloroform, shake vigorously for 15s, let stan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a mini-gene splicing reporter plasmid and construction method and application thereof. A sequence of the mini-gene splicing reporter plasmid is as shown in a sequence table <400>1. Three non-continuous sequences on a DMD gene are obtained through PCR (polymerase chain reaction) and inserted to pcDNA 3.1 respectively to construct the mini-gene splicing reporter plasmid. The mini-gene splicing reporter plasmid can be used for identifying and analyzing splicing regulation elements in exons and introns and detecting whether micromutation (point mutation and microdeletion / repetition) affects splicing of the exons or not.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a mini-gene splicing reporter plasmid and its construction method and application. Background technique [0002] RNA splicing is a very important biological process in eukaryotic gene expression. By removing introns and connecting exons, many functional mRNAs with coding information can be produced. It is crucial to the development and evolution of organisms important. [0003] The splicing of pre-mRNA is the process of removing introns and splicing exons to form mature mRNA under the catalysis of splicing bodies. one of the mechanisms. The entire splicing process is completed in the nucleus and is subject to fine and strict regulation. The mutation of the splice site will inevitably lead to the change of the splicing mode, and the correct sequence and position of the splice site are the necessary conditions to ensure the normal splicing of RNA. The splicing process requires ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/68
CPCC12Q1/6806C12Q1/6876C12Q2531/113C12Q2525/131
Inventor 张竹君杨城朱艳荣邓慧婷李辉
Owner NANKAI UNIV