Application of FHL3 gene in promotion of animal growth

A technology of animal growth and FHL3, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems that have not been seen to improve the growth rate and muscle mass of animals by transfecting FHL3 gene, and achieve the effect of high muscle yield and fast growth rate

Active Publication Date: 2017-11-24
HUAZHONG AGRI UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] So far, there has been no report on the improvement of animal growth rate and muscle mass by transgenic FHL3

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of FHL3 gene in promotion of animal growth
  • Application of FHL3 gene in promotion of animal growth
  • Application of FHL3 gene in promotion of animal growth

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Preparation of transgenic mice overexpressing the FHL3 gene:

[0039] 1.1pEGFP-N1L-MCK-FHL3 transgenic vector construction and linearization:

[0040] Total RNA was extracted from the mouse C2C12 myoblast cell line, and cDNA was obtained after reverse transcription. Using the CDS sequence (Genebank accession number: NM-010213.3) of the mouse FHL3 gene published in the NCBI database, design primers containing two restriction sites of Sal I and Not I:

[0041] FHL3-F1 GTCGACGCCACCATGAGCGAGGCATTTGAC

[0042] FHL3-R1-GCGGCCGCTCAGGGGCCTGCTTGGCTG

[0043] The CDS sequence of the FHL3 gene was obtained by ordinary PCR amplification, with a size of 890bp. The specific CDS sequence is:

[0044] GTCGACGCCACCATGAGCGAGGCATTTGACTGTGCAAAATGCAACGAGTCCTTGTACGGCCGCAAATACATCCAGACAGACAGTGGCCCCTACTGCGTTCCGTGCTATGACAACACCTTCGCCAACACCTGTGCTGAGTGCCAGCAGCTCATTGGGCATGATTCAAGGGAACTGTTCTATGAGGACCGCCACTTCCACGAGGGCTGCTTCCGCTGCTGCCGATGCCAGCGCTCCCTTGCCGATGAGCCCTTCACCTGTCAGGACAGTGAGCTTCTGTGTAATGAGT...

Embodiment 2

[0056] Application of FHL3 gene in promoting animal growth:

[0057] 1) The growth rate of the transgenic mice overexpressing the FHL3 gene was significantly faster than that of the wild type

[0058] After the FHL3 gene-transferred F1 generation mice are paired, the pregnancy status of the mice is regularly observed. When the mother mouse is about to give birth, the frequency of inspection is increased. Heavy and well marked. At the same time, the supply of rat food and drinking water is sufficient, and the litter is replaced regularly to ensure a good living environment for the mice. Thereafter, the body weight of each mouse was weighed every week until the 8th week, and the record of the mouse body weight gain was completed. During this period, all newborn mice were cut from their tails at the age of 2 weeks for DNA extraction and PCR identification. They were weaned at the age of 3 weeks and raised in separate cages from the female mice, and the male and female mice were...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of animal transgenosis, and discloses application of FHL3 gene in promotion of animal growth. The FHL3 gene is over-expressed in animal bodies, and the growth rate and muscle content of animals can be obviously improved. The invention firstly discloses that the over-expression of the FHL3 gene can promote the growth of individuals and the increase of the muscle content, and firstly discovers the function of the FHL3 gene in the aspect. The invention indicates that the FHL3 gene can serve as a candidate gene for preparing transgenosis livestock with high growth rate and high muscle yield.

Description

technical field [0001] The invention belongs to the technical field of animal transgenesis, and specifically relates to the application of FHL3 gene in promoting animal growth. Overexpressing the FHL3 gene in the animal body can significantly improve the growth speed and muscle mass of the animal. Background technique [0002] Animal husbandry is an integral part of agriculture and an important pillar of agricultural economy, and plays an important role in the national economy. For farmers, with less input, more output can be obtained, which can significantly improve economic benefits. In addition, the improvement of people's living standards also requires the consumption of more meat, eggs, milk and other animal foods. The improvement of livestock breeds by traditional breeding technology requires a lot of manpower and material resources, and the cycle is long and the effect is slow. The above drawbacks can be overcome by developing and utilizing new genetic improvement t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12A01K67/027
CPCA01K67/0278A01K2207/15A01K2217/052A01K2267/02C07K14/4702
Inventor 左波徐在言许海洋
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap