Bacteriophage electrochemical luminescence signal amplification probe and preparation method and application thereof

A phage electrochemical and luminescent signal technology, applied in the field of biochemical analysis, can solve the problems of uncontrollable labeling, non-detection methods, and poor biological stability of nanomaterials, and achieve high signal amplification efficiency, stable system, and easy preservation.

Inactive Publication Date: 2017-12-01
广州博徕斯生物科技股份有限公司
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the problem with these methods is that none of them is a direct detection method, but detects by exponential amplification of nucleic acid
However, these methods also have some problems, including: 1) the biocompatibility of nanomaterials, the biological stability of nanomaterials is usually relatively poor, and it is easy to focus in some biological systems (such as high-salt environments), which affects the detection accuracy. 2) The labeling of nanomaterials is usually uncontrollable, because the synthesis of nanomaterials is difficult to achieve precise controllability (including its size, shape, etc.), which directly affects the labeling of nanomaterials and biological probes. Controllability, so that the detection accuracy of the probe is difficult to meet the requirements of clinical detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacteriophage electrochemical luminescence signal amplification probe and preparation method and application thereof
  • Bacteriophage electrochemical luminescence signal amplification probe and preparation method and application thereof
  • Bacteriophage electrochemical luminescence signal amplification probe and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment one: Preparation of terpyridine ruthenium-N-hydroxysuccinimide ester (Ru(bpy) 3 2+ -NHS)

[0035] 1. Synthesis of terpyridine ruthenium hexafluorophosphate (Ru(bpy) 2 (dcbpy)(PF 6 ) 2 )

[0036] 0.2 g cis-dichlorobis(2,2′-bipyridyl)ruthenium(II), 0.15 g 2,2′-bipyridine-4,4′-dicarboxylic acid, 0.2 g sodium bicarbonate, 32 mL methanol and Add 8 mL of deionized water into a three-necked flask, install a condenser, heat to 80°C in a silicone oil bath under magnetic stirring, and heat to reflux for 10 hours. The reaction solution gradually changes from purple-brown to orange-red. After the reaction, the pH value of the reaction solution was adjusted to 4.4 with concentrated sulfuric acid, and the temperature was lowered in an ice bath for 2 hours in a dark environment to precipitate excess 2,2'-bipyridine-4,4'-dicarboxylic acid , and then vacuum-filtered, and the filtrate was collected to obtain the carboxylated terpyridine ruthenium filtrate. Add 12.5 mL o...

Embodiment 2

[0039] Example 2: Preparation of streptavidin-M13 phage

[0040] 1. Design specific primers, and clone the DNA fragment of streptavidin (SA) into the phagemid vector pC to obtain the plasmid pC-SA.

[0041] The DNA sequence of streptavidin (SA) is as follows (as shown in SEQ ID NO: 1 in the sequence listing):

[0042] atggacccctccaaggactcgaaggcccaggtctcggctgccgaggccggcatcaccggcacctggtacaaccagctcggctcgaccttcatcgtgaccgcgggcgccgacggcgccctgaccggaacctacgagtcggccgtcggcaacgccgagagccgctacgtcctgaccggtcgttacgacagcgccccggccaccgacggcagcggcaccgccctcggttggacggtggcctggaagaataactaccgcaacgcccactccgcgaccacgtggagcggccagtacgtcggcggcgccgaggcgaggatcaacacccagtggctgctgacctccggcaccaccgaggccaacgcctggaagtccacgctggtcggccacgacaccttcaccaaggtgaagccgtccgccgcctccatcgacgcggcgaagaaggccggcgtcaacaacggcaacccgctcgacgccgttcagcag。

[0043] Upstream primer: tataat GGCCCAGCCGGCC ATGGCCATGGACCCCTCCAAG (the underlined part is the SfiI restriction site);

[0044] Downstream primer: ataaa TGCGGCCGC CTGCTGAACGGCGTC (th...

Embodiment 3

[0058] Example 3: Preparation of streptavidin-M13 phage-ruthenium signal amplification probe

[0059] 100 μL of 10 12 Streptavidin-M13 phage at pfμ / mL was added to 20μL PEG / NaCl mixed solution (20%w / v PEG8000 / 2.5M NaCl) and mixed, placed on ice for 1 hour, and then centrifuged at room temperature at 11000rpm for 20 Minutes, the M13 phage pellets were obtained. Resuspend the M13 phage pellet in 100 μL of 0.2M NaHCO pH 8.3 3 In the buffer, add 5 μL of 10 mg / mL terpyridine ruthenium-N-hydroxysuccinimide ester (Ru(bpy) 3 2+ -NHS), and incubated overnight at 4°C with shaking in the dark. 10 μL of 1.5M hydroxylamine solution at pH 8.5 was added to the M13 phage solution and incubated at room temperature for 1 hour to terminate the labeling reaction. It was then filtered through PEG precipitation and a Zeba centrifugal desalting column to remove unreacted ruthenium-N-hydroxysuccinimide terpyridyl ester. After purification, streptavidin-M13 phage-ruthenium signal amplification p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a bacteriophage electrochemical luminescence signal amplification probe and a preparation method and application thereof. The bacteriophage electrochemical luminescence signal amplification probe comprises M13 bacteriophage, streptavidin expressed in the M13 bacteriophage in a fusion manner and tris-(bipyridyl) ruthenium which is covalently connected to the M13 bacteriophage. According to the bacteriophage electrochemical luminescence signal amplification probe, the M13 bacteriophage is used as a connecting skeletion for amplifying tris-(bipyridyl) ruthenium signals, and has the advantages of stable system, difficulty in gathering, easiness in storage and the like. The prepared signal amplification probe has the advantages of simplicity, controllability, high signal amplification efficiency and the like, and can be used for quantitative detection of nucleic acid or antigen and the like.

Description

technical field [0001] The invention belongs to the technical field of biochemical analysis, and in particular relates to a bacteriophage electrochemiluminescent signal amplification probe and its preparation method and application. Background technique [0002] Accurate, sensitive and specific biological analysis of functional molecules (such as nucleic acids and proteins) is of great significance in the fields of life science and biomedical research and clinical diagnosis of diseases. Since the 21st century, thanks to multidisciplinary synthesis, nucleic acid probes and sensing technologies have developed deeper and broader. [0003] Existing nucleic acid detection technologies mainly rely on nucleic acid amplification techniques, such as polymerase chain reaction (PCR), nucleic acid sequence-dependent amplification (NASBA), loop-mediated isothermal amplification (LAMP), rolling circle amplification ( RCA), etc., by combining these amplification products with detection te...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C09K11/06C12Q1/68
CPCC09K11/06C09K2211/185C12Q1/6816C12Q2563/131C12Q2563/103
Inventor李然刘晋峰苏玲玲
Owner广州博徕斯生物科技股份有限公司