Gene for regulating transfer of long-chain diacid of candida tropicalis and application of gene
A technology of Candida tropicalis and long-chain dibasic acid, which is applied in the field of genetic engineering, can solve the problems of poor product quality, complicated process, harsh conditions of long-chain dibasic acid, etc., to improve the yield and output, and improve the transport rate. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Verification of Candida tropicalis ctlpA gene function
[0025] 1. The construction method of Candida tropicalis genetically engineered recombinant bacteria, the steps are as follows:
[0026] (1) extract the genomic DNA of Candida tropicalis (Candida tropicalis) thalline, and use the genomic DNA as a template to carry out PCR amplification to obtain the homology arm ctlpA1 with a length of 581bp. The PCR primer sequence is as follows:
[0027] CtlpA 1 :G GAATTC CTATTATCATCCTTGGGGTT;
[0028] CtlpA R 1 :ATAATAGGATTTAGCGGAGGCATGATACCTGCT;
[0029] Wherein, the underline is marked as the EcoR I restriction site;
[0030] The PCR amplification system is 50 μl:
[0031] 2×HiFi-PCR master 25μl, primer CtlpA F with a concentration of 10μmol / L 1 2.5 μl, primer CtlpA R with a concentration of 10 μmol / L 1 2.5 μl, template 2.5 μl, with ddH 2 O make up 50 μl;
[0032] The PCR amplification procedure is as follows:
[0033] Pre-denaturation at 95°C for 5min;...
Embodiment 2
[0084] Example 2 Candida tropicalis ctlpA gene multi-copy strain construction
[0085] On the basis of obtaining the full-length ctlpA gene, design specific primers to clone the target gene, and configure the vector and target gene into a recombination reaction system through seamless cloning technology to carry out the recombination reaction. Transform into DH5α competent medium, and screen positive clones. After the sequencing was correct, the extracted plasmid was electrotransformed into competent Candida tropicalis. Fermentation verification of the effect of increasing the copy number of ctlpA gene on the rate of cell oil absorption. The core of its technology is to use the principle of homologous recombination to linearize the vector, and introduce the terminal sequence of the linearized vector at the 5' end of the PCR primer of the insert fragment, so that the 5' and 3' ends of the PCR product are respectively equipped with the linearized vector Consistent sequences at...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap