Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene for regulating transfer of long-chain diacid of candida tropicalis and application of gene

A technology of Candida tropicalis and long-chain dibasic acid, which is applied in the field of genetic engineering, can solve the problems of poor product quality, complicated process, harsh conditions of long-chain dibasic acid, etc., to improve the yield and output, and improve the transport rate. Effect

Active Publication Date: 2017-12-19
QILU UNIV OF TECH
View PDF16 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with the microbial fermentation method, the production of long-chain dibasic acids by the chemical method has harsh conditions, complicated processes, not enough environmental protection, and poor product quality. Therefore, many researchers have turned their targets to microbial fermentation with broad development prospects and great industrial value.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for regulating transfer of long-chain diacid of candida tropicalis and application of gene
  • Gene for regulating transfer of long-chain diacid of candida tropicalis and application of gene
  • Gene for regulating transfer of long-chain diacid of candida tropicalis and application of gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Verification of Candida tropicalis ctlpA gene function

[0025] 1. The construction method of Candida tropicalis genetically engineered recombinant bacteria, the steps are as follows:

[0026] (1) extract the genomic DNA of Candida tropicalis (Candida tropicalis) thalline, and use the genomic DNA as a template to carry out PCR amplification to obtain the homology arm ctlpA1 with a length of 581bp. The PCR primer sequence is as follows:

[0027] CtlpA 1 :G GAATTC CTATTATCATCCTTGGGGTT;

[0028] CtlpA R 1 :ATAATAGGATTTAGCGGAGGCATGATACCTGCT;

[0029] Wherein, the underline is marked as the EcoR I restriction site;

[0030] The PCR amplification system is 50 μl:

[0031] 2×HiFi-PCR master 25μl, primer CtlpA F with a concentration of 10μmol / L 1 2.5 μl, primer CtlpA R with a concentration of 10 μmol / L 1 2.5 μl, template 2.5 μl, with ddH 2 O make up 50 μl;

[0032] The PCR amplification procedure is as follows:

[0033] Pre-denaturation at 95°C for 5min;...

Embodiment 2

[0084] Example 2 Candida tropicalis ctlpA gene multi-copy strain construction

[0085] On the basis of obtaining the full-length ctlpA gene, design specific primers to clone the target gene, and configure the vector and target gene into a recombination reaction system through seamless cloning technology to carry out the recombination reaction. Transform into DH5α competent medium, and screen positive clones. After the sequencing was correct, the extracted plasmid was electrotransformed into competent Candida tropicalis. Fermentation verification of the effect of increasing the copy number of ctlpA gene on the rate of cell oil absorption. The core of its technology is to use the principle of homologous recombination to linearize the vector, and introduce the terminal sequence of the linearized vector at the 5' end of the PCR primer of the insert fragment, so that the 5' and 3' ends of the PCR product are respectively equipped with the linearized vector Consistent sequences at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A gene for regulating transfer of long-chain diacid of candida tropicalis and an application of the gene are disclosed. Transfer gene ctlpA of long-chain diacid of candida tropicalis has the nucleotide sequence shown as SEQ ID NO.1. Transfer protein CtLpA of long-chain aliphatic acid has the nucleotide sequence shown as SEQ ID NO.2. The fact that transfer protein gene ctlpA of long-chain diacid in candida tropicalis is a key gene in a transmembrane transfer process of long-chain diacid is found for the first time in the invention. Expression of the transfer protein gene ctlpA can promote intracellular-to-extracellular transmembrane transfer of long-chain diacid, and a basis of synthesizing long-chain diacid through a new approach of taking grease as a raw material is founded.

Description

technical field [0001] The invention relates to a gene for regulating long-chain dibasic acid transport of Candida tropicalis and its application, and belongs to the technical field of genetic engineering. Background technique [0002] Long-chain dibasic acids generally refer to straight-chain aliphatic dicarboxylic acids with more than 12 carbon atoms in the carbon chain. It is an important raw material with high industrial application value and can be used to synthesize important chemical intermediates such as special nylon, high-grade musk, adhesive, hot melt adhesive, medicine, and pesticide. Long-chain dibasic acids cannot be obtained directly from nature. At present, there are two main methods for producing long-chain dibasic acids at home and abroad: chemical method and fermentation method. Compared with the microbial fermentation method, the production of long-chain dibasic acids by the chemical method has harsh conditions, complicated process, not environmentally f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/31C07K14/40C12N15/81C12N1/19C12P7/64
CPCC07K14/40C12N15/815C12P7/64
Inventor 汪俊卿王瑞明修翔苏静杨晓慧彭健薛乐
Owner QILU UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com