Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for efficiently localizing exogenous mammal cytoplasmic protein in cell nucleus and application thereof

A cytoplasmic protein and mammalian technology, applied in the field of life sciences, can solve problems such as inaccurate experimental results, inability to obtain dose-effect relationships, and inconvenience

Inactive Publication Date: 2018-01-26
江西省妇幼保健院
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, only 1-2 nuclear localization sequence signals can be imported at a time, which cannot meet the requirements of importing multiple signals at the same time. Therefore, the dose-effect relationship cannot be obtained, resulting in inaccurate experimental results in the later stage.
The method of double enzyme digestion is generally adopted in the construction of the plasmid. The existing technology generally adopts the method of double enzyme digestion in the construction of the plasmid, which is to design double enzyme digestion sites at both ends of the NLS, and carry out on the vector at the same time. Double enzyme digestion, only one section of NLS can be inserted at a time, which is neither convenient nor meet the requirements of inserting multiple strips
Or directly synthesize one or more NLSs in vitro, but this method generally synthesizes at most two or 54 bases, too long will increase the cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficiently localizing exogenous mammal cytoplasmic protein in cell nucleus and application thereof
  • Method for efficiently localizing exogenous mammal cytoplasmic protein in cell nucleus and application thereof
  • Method for efficiently localizing exogenous mammal cytoplasmic protein in cell nucleus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] A method for efficiently localizing exogenous mammalian cytoplasmic proteins in the nucleus is as follows:

[0032] (1) The synthesized single-stranded NLS sequence, forward: 5-"GTCGACCCGAAGAAGAAGCGTAAGGTC"-3, shown in SEQ ID NO.1; reverse: 5-"CAGCTGGACCTTACGCTTCTTCTTCGG"-3, shown in SEQ ID NO.2; using annealing To synthesize double-stranded DNA, the reaction system is as follows:

[0033] 10x annealing buffer 2ul (100mM Tris-HCL (pH=7.5), 10mM EDTA, 1M NaCl)

[0034] Oligonucleotide 1 final concentration 100nM

[0035] Oligonucleotide 2 final concentration 100nM

[0036] Make up to 20ul with nuclease-free water

[0037] Reaction conditions: 95°C: 5 minutes, 70°C: 10 minutes, gradually cool to room temperature.

[0038](2) At the same time, pRK5-Sufu-GFP will be digested with SalI enzyme, and the reaction system is as follows:

[0039] pRK5-Sufu-GFP 2ug

[0040] 10xNEB cutsmart buffer 5ul

[0041] SalI enzyme 1ul

[0042] wxya 2 O make up to 50ul

[0043] Reac...

Embodiment 2

[0062] The control plasmid and the positive plasmid were transfected into Sufu gene knockout MEFs, and the cells were harvested 24 hours later to extract RNA, and a fluorescent quantitative PCR experiment was performed to detect the expression difference of S5NG on the downstream target genes ptch1 and gli1 of the Hedgehog signaling pathway ( Figure 3a with Figure 3b ).

Embodiment 3

[0064] The control plasmid and positive plasmid were transfected into Sufu gene knockout MEFs, and the luciferase reporter gene and sea cucumber gene plasmids of the 8xGli transcription factor binding site were transfected at the same time. After 48 hours, the reporter gene detection system was used to detect the difference. The effect of the plasmid on the transcriptional regulation of Gli1 protein ( Figure 4 ).

[0065] As an intermediate regulator of the Hedgehog signaling pathway, Sufu regulates the transcriptional activity of the transcription factor Gli1, and the location of Sufu will definitely affect its regulation of the transcriptional activity of the Gli protein. Therefore, the luciferase reporter gene system was used to detect the regulation of Gli1 transcriptional activity by these Sufu-GFP plasmids inserted with different numbers of NLS; at the same time, the method of fluorescent quantitative PCR was used to detect the effect of Sufu-GFP inserted with different...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for efficiently localizing exogenous mammal cytoplasmic protein in a cell nucleus and application thereof. According to the method, a pRK5-Sufu-GFP expression vector is digested by utilizing SalI single enzyme, then NLS is ligated into the vector by utilizing ligase, subsequently nuclear localization vectors pRK5-Sufu-nNLS-GFP (SnNG) with unequal numbers of inserted NLSs are obtained by transformation, and finally cytoplasmic protein is successfully localized in the cell nucleus. In the method disclosed by the invention, multiple NLSs can be inserted at one time, inserted n plasmid vectors (n being 1-5) are obtained simultaneously, and the exogenous cytoplasmic protein can be efficiently localized in the cell nucleus. The transfection of the plasmid into mouse fibroblasts (MEFs) is achieved by one-time construction of the cytoplasmic protein with 1-5 NLSs, so as to study the dose-effect relationship between the localization of the cytoplasmic protein incytoplasm / karyon and the biological activity and function of the cytoplasmic protein in cells.

Description

technical field [0001] The invention belongs to the field of life sciences, and specifically relates to a method for efficiently localizing exogenous mammalian cytoplasmic proteins in the nucleus and an application thereof. Background technique [0002] The location of proteins in cells is of great significance to the function of proteins. Once a wrong location occurs, it will have irreversible consequences on normal cell activities, such as developmental defects and tumors. Due to the nuclear localization signal (NLS), some proteins bind to the nuclear import protein importin, and then undergo a series of reactions to enter the nucleus to perform their corresponding functions, such as transcriptional promoters and transcriptional repressors. However, there are still many proteins without NLS that can be localized in the nucleus and may depend on other pathways, such as molecular chaperones. Therefore, it is crucial to study the localization of proteins in the nucleus and t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/85
Inventor 张子宇邹阳杨必成刘发英罗勇
Owner 江西省妇幼保健院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com