Check patentability & draft patents in minutes with Patsnap Eureka AI!

Rice efficient conversion vector pCXUN-Cas9-sgRNA and construction method thereof

A technology of pcxun-cas9-sgRNA and pcxun-cas9 is applied in the field of high-efficiency transformation vector pCXUN-Cas9-sgRNA of rice and its construction, which can solve the problems of low transformation efficiency, inconsistent genotypes in different tissues, and effect limitations, and achieve high-efficiency transformation. , the effect of transforming the host's convenience

Inactive Publication Date: 2018-02-13
HUAZHONG AGRI UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there have been many reports on the application of CRISPR / CAS9 technology in different organisms. However, some methods in rice still have the disadvantages of low transformation efficiency, inconsistent genotypes of different tissues, and off-target phenomena. Therefore, its application The effect is limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice efficient conversion vector pCXUN-Cas9-sgRNA and construction method thereof
  • Rice efficient conversion vector pCXUN-Cas9-sgRNA and construction method thereof
  • Rice efficient conversion vector pCXUN-Cas9-sgRNA and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] The preparation of embodiment 1 starting vector, intermediate plasmid vector

[0072] 1. Obtaining the Cas9 gene fragment

[0073] The rice CAS9 gene (provided by Qu Lijia, State Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, nucleotide sequence, see SEQ ID NO: 4), has been cloned into the pH-Ubi-cas9-7 plasmid (miao et al., 2013 ) as a template, with Cas9-F (5'-ATGGCCCCAAAGAAGA AGCG-3' and Cas9-R (5'-TCAATCGCCGCCGAGTTGTG-3') as primers for PCR amplification PCR amplification, the gene fragment of about 4.1k b was obtained (see figure 2 , and the sequence table SEQ ID NO: 4), the obtained PCR product was cloned into the pCXUN vector (see SEQ ID NO: 1 for the sequence) (chen et al., 2009), and the corresponding samples of the positive clones were sequenced (Beijing Qingke Biotechnology Co., Ltd. sequencing) to verify the correctness of the target PCR product.

[0074] The PCR process is as follows:

[0075]

[0076] The Cas9 target f...

Embodiment 2

[0083] Example 2 Construction of Transformation Vector pCXUN-Cas9-sgRNA

[0084] A specific sgRNA was designed with the OsTAA1 gene (LOC_Os01g07500) in rice as the target gene. The TIGR sequence number of the OsTAA1 gene is LOC_Os01g07500, and the target sequence is CCC GACCATGTTCGAGGAGTTCT (PAM sequence is underlined). The intermediate vector pCXUN-Cas9 obtained in Example 1 was digested with KpnI into linear DNA, and sgRNA was introduced by overlapping PCR amplification. Specific steps are as follows;

[0085] 1) Using the plasmid carrying the U3 promoter as a template, design the adapter primers before and after the U3 promoter (the uppercase letters are the cohesive terminal repeats on the vector produced by KpnI digestion) as follows:

[0086] OsU3-F: CCCCTTTCGCCAGGGGTACCgtaattcatccaggtctccaag

[0087] OsU3-R:TACGAATTCGAGCTCGGTACCgctgtgccgtacgacggtacg

[0088] 2) Introduce the target gene-specific sequence AGAACTCCTCGAACATGGTC into the U3 promoter, use NEB Cutter sof...

Embodiment 3

[0100] Example 3 Using the recombinant vector pCXUN-Cas9-sgRNA to transform Agrobacterium and transform the rice host

[0101] The sequenced positive plasmid pCXUN-Cas9-sgRNA (OsTAA1CR) was electrotransformed into Agrobacterium (EHA105) and infected with rice callus. The transformed variety is rice Zhonghua 11 (ZH11, from the Institute of Crop Science, Chinese Academy of Agricultural Sciences), and the specific transformation steps are as follows:

[0102]1) Dehull mature embryos of rice variety Zhonghua 11, soak in 70% ethanol for 1 min, sterilize with 0.15% mercuric chloride for 20 min, and wash with sterile water for 3 to 4 times; inoculate the obtained explants on the induction medium, and Induce callus by dark culture at 26°C;

[0103] 2) After induction culture for 35 days, get strong, granular callus and transfer to Oc subculture medium for subculture;

[0104] 3) Take the granules of the callus subcultured for 20 days, insert it into the Ol pre-culture medium, and cu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant genetic engineering, and in particular relates to a rice high-efficiency transformation vector pCXUN-Cas9-sgRNA and a construction method thereof. The present invention uses CRISPR / CAS9 technology to efficiently transform rice knockout-related genes to obtain a vector, which is named pCXUN-CAS9-sgRNA. The vector contains the nucleotide sequence shown in SEQ ID NO: 1 in the sequence table. The present invention utilizes the sgRNA method to mutate the rice target gene to obtain a high-efficiency transformation carrier, which is a one-element carrier. The recombinant vector of the present invention can be used for directional mutation of the rice target gene, to study the functions and effects of related genes in rice, and can also be used to construct corresponding Gene mutants and large deletions. The carrier of the invention has high transformation efficiency and targeting mutation efficiency, and can be stably inherited and applied in rice.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a rice high-efficiency transformation vector pCXUN-Cas9-sgRNA and a construction method thereof. The invention uses the sgRNA method to mutate the rice target gene to obtain a high-efficiency transformation vector. The recombinant vector of the present invention can be used for directional mutation of rice target genes, for studying the functions and effects of related genes in rice, and can also be used for constructing corresponding gene mutants and large fragment deletions. Background technique [0002] Mali and Cong et al. (2013) reported a new method of gene knockout in cell lines based on CRISPR-Cas9 technology in "Science". This method is different from previous methods by using a Cas9 nuclease from Streptococcus , a tracrRNA (trans-activating crRNA) with a constant sequence and a 20nt-crRNA (CRISPR RNAs) specifically complementary to the tar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/64
CPCC12N15/8205C12N15/64
Inventor 赵云德王荣臣张涛和玉兵
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More