Rice efficient conversion vector pCXUN-Cas9-sgRNA and construction method thereof
A technology of pcxun-cas9-sgRNA and pcxun-cas9 is applied in the field of high-efficiency transformation vector pCXUN-Cas9-sgRNA of rice and its construction, which can solve the problems of low transformation efficiency, inconsistent genotypes in different tissues, and effect limitations, and achieve high-efficiency transformation. , the effect of transforming the host's convenience
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0071] The preparation of embodiment 1 starting vector, intermediate plasmid vector
[0072] 1. Obtaining the Cas9 gene fragment
[0073] The rice CAS9 gene (provided by Qu Lijia, State Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, nucleotide sequence, see SEQ ID NO: 4), has been cloned into the pH-Ubi-cas9-7 plasmid (miao et al., 2013 ) as a template, with Cas9-F (5'-ATGGCCCCAAAGAAGA AGCG-3' and Cas9-R (5'-TCAATCGCCGCCGAGTTGTG-3') as primers for PCR amplification PCR amplification, the gene fragment of about 4.1k b was obtained (see figure 2 , and the sequence table SEQ ID NO: 4), the obtained PCR product was cloned into the pCXUN vector (see SEQ ID NO: 1 for the sequence) (chen et al., 2009), and the corresponding samples of the positive clones were sequenced (Beijing Qingke Biotechnology Co., Ltd. sequencing) to verify the correctness of the target PCR product.
[0074] The PCR process is as follows:
[0075]
[0076] The Cas9 target f...
Embodiment 2
[0083] Example 2 Construction of Transformation Vector pCXUN-Cas9-sgRNA
[0084] A specific sgRNA was designed with the OsTAA1 gene (LOC_Os01g07500) in rice as the target gene. The TIGR sequence number of the OsTAA1 gene is LOC_Os01g07500, and the target sequence is CCC GACCATGTTCGAGGAGTTCT (PAM sequence is underlined). The intermediate vector pCXUN-Cas9 obtained in Example 1 was digested with KpnI into linear DNA, and sgRNA was introduced by overlapping PCR amplification. Specific steps are as follows;
[0085] 1) Using the plasmid carrying the U3 promoter as a template, design the adapter primers before and after the U3 promoter (the uppercase letters are the cohesive terminal repeats on the vector produced by KpnI digestion) as follows:
[0086] OsU3-F: CCCCTTTCGCCAGGGGTACCgtaattcatccaggtctccaag
[0087] OsU3-R:TACGAATTCGAGCTCGGTACCgctgtgccgtacgacggtacg
[0088] 2) Introduce the target gene-specific sequence AGAACTCCTCGAACATGGTC into the U3 promoter, use NEB Cutter sof...
Embodiment 3
[0100] Example 3 Using the recombinant vector pCXUN-Cas9-sgRNA to transform Agrobacterium and transform the rice host
[0101] The sequenced positive plasmid pCXUN-Cas9-sgRNA (OsTAA1CR) was electrotransformed into Agrobacterium (EHA105) and infected with rice callus. The transformed variety is rice Zhonghua 11 (ZH11, from the Institute of Crop Science, Chinese Academy of Agricultural Sciences), and the specific transformation steps are as follows:
[0102]1) Dehull mature embryos of rice variety Zhonghua 11, soak in 70% ethanol for 1 min, sterilize with 0.15% mercuric chloride for 20 min, and wash with sterile water for 3 to 4 times; inoculate the obtained explants on the induction medium, and Induce callus by dark culture at 26°C;
[0103] 2) After induction culture for 35 days, get strong, granular callus and transfer to Oc subculture medium for subculture;
[0104] 3) Take the granules of the callus subcultured for 20 days, insert it into the Ol pre-culture medium, and cu...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com